ID: 1013480227

View in Genome Browser
Species Human (GRCh38)
Location 6:110546646-110546668
Sequence AAACTCAGTATGTTCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013480225_1013480227 -9 Left 1013480225 6:110546632-110546654 CCTATTGAAACCTCAAACTCAGT No data
Right 1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG No data
1013480223_1013480227 5 Left 1013480223 6:110546618-110546640 CCCTACAAAGATGTCCTATTGAA No data
Right 1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG No data
1013480224_1013480227 4 Left 1013480224 6:110546619-110546641 CCTACAAAGATGTCCTATTGAAA No data
Right 1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG No data
1013480222_1013480227 24 Left 1013480222 6:110546599-110546621 CCAACTGTCTTCTACGCATCCCT No data
Right 1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013480227 Original CRISPR AAACTCAGTATGTTCAAAAG TGG Intergenic
No off target data available for this crispr