ID: 1013483210

View in Genome Browser
Species Human (GRCh38)
Location 6:110569727-110569749
Sequence CTCTGTTACAGACTGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013483204_1013483210 5 Left 1013483204 6:110569699-110569721 CCCAACACTAAGTCTCTACACCT No data
Right 1013483210 6:110569727-110569749 CTCTGTTACAGACTGAAGCAGGG No data
1013483203_1013483210 15 Left 1013483203 6:110569689-110569711 CCTCAGCTGTCCCAACACTAAGT No data
Right 1013483210 6:110569727-110569749 CTCTGTTACAGACTGAAGCAGGG No data
1013483205_1013483210 4 Left 1013483205 6:110569700-110569722 CCAACACTAAGTCTCTACACCTG No data
Right 1013483210 6:110569727-110569749 CTCTGTTACAGACTGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013483210 Original CRISPR CTCTGTTACAGACTGAAGCA GGG Intergenic
No off target data available for this crispr