ID: 1013490814

View in Genome Browser
Species Human (GRCh38)
Location 6:110644750-110644772
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 2, 1: 1, 2: 2, 3: 32, 4: 340}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013490814_1013490820 -3 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490820 6:110644770-110644792 TAGAACTACAGAGGAGGTGAAGG 0: 1
1: 0
2: 0
3: 23
4: 213
1013490814_1013490833 21 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490833 6:110644794-110644816 GGCCAGGGGGAGGGGAGGCAGGG 0: 1
1: 1
2: 25
3: 249
4: 2074
1013490814_1013490836 23 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490836 6:110644796-110644818 CCAGGGGGAGGGGAGGCAGGGGG 0: 1
1: 2
2: 25
3: 305
4: 2092
1013490814_1013490823 0 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490823 6:110644773-110644795 AACTACAGAGGAGGTGAAGGGGG No data
1013490814_1013490825 6 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490825 6:110644779-110644801 AGAGGAGGTGAAGGGGGCCAGGG 0: 1
1: 0
2: 3
3: 89
4: 839
1013490814_1013490832 20 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490832 6:110644793-110644815 GGGCCAGGGGGAGGGGAGGCAGG 0: 1
1: 1
2: 39
3: 326
4: 2790
1013490814_1013490829 12 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490829 6:110644785-110644807 GGTGAAGGGGGCCAGGGGGAGGG No data
1013490814_1013490821 -2 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490821 6:110644771-110644793 AGAACTACAGAGGAGGTGAAGGG 0: 1
1: 0
2: 1
3: 24
4: 309
1013490814_1013490831 16 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490831 6:110644789-110644811 AAGGGGGCCAGGGGGAGGGGAGG 0: 1
1: 0
2: 13
3: 235
4: 2022
1013490814_1013490826 7 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490826 6:110644780-110644802 GAGGAGGTGAAGGGGGCCAGGGG 0: 1
1: 0
2: 5
3: 96
4: 850
1013490814_1013490834 22 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490834 6:110644795-110644817 GCCAGGGGGAGGGGAGGCAGGGG 0: 1
1: 0
2: 20
3: 287
4: 2279
1013490814_1013490822 -1 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490822 6:110644772-110644794 GAACTACAGAGGAGGTGAAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1013490814_1013490824 5 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490824 6:110644778-110644800 CAGAGGAGGTGAAGGGGGCCAGG 0: 1
1: 0
2: 7
3: 75
4: 837
1013490814_1013490828 11 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490828 6:110644784-110644806 AGGTGAAGGGGGCCAGGGGGAGG No data
1013490814_1013490837 24 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490837 6:110644797-110644819 CAGGGGGAGGGGAGGCAGGGGGG No data
1013490814_1013490827 8 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490827 6:110644781-110644803 AGGAGGTGAAGGGGGCCAGGGGG 0: 1
1: 0
2: 3
3: 111
4: 969
1013490814_1013490830 13 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490830 6:110644786-110644808 GTGAAGGGGGCCAGGGGGAGGGG No data
1013490814_1013490819 -9 Left 1013490814 6:110644750-110644772 CCCTCCTTCCTCTGGTGTTTTAG 0: 2
1: 1
2: 2
3: 32
4: 340
Right 1013490819 6:110644764-110644786 GTGTTTTAGAACTACAGAGGAGG 0: 1
1: 0
2: 0
3: 27
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013490814 Original CRISPR CTAAAACACCAGAGGAAGGA GGG (reversed) Intronic
900671987 1:3860006-3860028 ATAAAGCGCCAGAGAAAGGAAGG - Intronic
901148892 1:7087269-7087291 TTAAAACATCATAGGAAGCAGGG - Intronic
901234019 1:7657771-7657793 CCCCAACACCAGAGCAAGGAGGG + Intronic
903096038 1:20974732-20974754 CTAATCCAGCAGAGGAAGGGGGG + Intronic
904927882 1:34062726-34062748 CTCAAACACCAGCAGAAGCAAGG - Intronic
905868027 1:41386825-41386847 CCAAAGGACCAGAGGAAGGTTGG + Intergenic
907556401 1:55348272-55348294 CAAAAACCTCACAGGAAGGATGG - Intergenic
908218547 1:61980051-61980073 AGAAAACAGCAGAGGCAGGAAGG - Intronic
911047585 1:93641250-93641272 TTAAAAGACCAGAGGATGGACGG - Intronic
911124062 1:94323779-94323801 AGAAAACCCCAGAGGCAGGAAGG + Intergenic
914430233 1:147613949-147613971 CCAAAACACTTGAGGGAGGAGGG - Intronic
915340697 1:155175163-155175185 CTAAAGGCCCAGAGGAGGGACGG - Intronic
916488177 1:165277754-165277776 CTAAAATAGCAGAGCAAGGAAGG + Intronic
916642150 1:166741709-166741731 CTAAAAAACCAGAGGCTTGAAGG - Intergenic
916683808 1:167126911-167126933 CTGAAACACCAGAAGAAGGTGGG + Exonic
916736735 1:167614182-167614204 AAAAAACAACAAAGGAAGGAAGG - Intergenic
918103793 1:181399110-181399132 CTACAACTTCAGAGGAAGGACGG - Intergenic
918616652 1:186551558-186551580 AAAAAACAACAGAGGAAGAAAGG - Intergenic
919503744 1:198371545-198371567 ATAAAAAAAAAGAGGAAGGAGGG + Intergenic
920051702 1:203168277-203168299 CAGAACCACCAGGGGAAGGAAGG + Intronic
920854303 1:209650916-209650938 CCAAAACACAAGAGGAAGAATGG + Exonic
921085294 1:211785396-211785418 CTATAACATGAGGGGAAGGAAGG - Intronic
921614867 1:217254297-217254319 CTAAGACAGCAGAGTAAAGAAGG + Intergenic
923206755 1:231766561-231766583 CTAAATGAGCAGAGGAAGGGTGG + Intronic
924089008 1:240483833-240483855 CTCAAAGAGCAGAGCAAGGAGGG + Intergenic
924145728 1:241072773-241072795 CGATAGCACCAGAGGCAGGATGG + Intronic
924464390 1:244286746-244286768 CAAAAATACCATAGAAAGGATGG - Intergenic
924741983 1:246799535-246799557 CTAAAACACGAGGGAAAGAATGG - Intergenic
1063775961 10:9264439-9264461 CTACATCACTAGAGGAAGGTCGG + Intergenic
1064779839 10:18822927-18822949 ATGAAAGGCCAGAGGAAGGAGGG + Intergenic
1064807129 10:19147973-19147995 ATGAAACAGGAGAGGAAGGAAGG + Intronic
1065269094 10:24008517-24008539 GAAAACCACCAGATGAAGGAGGG + Intronic
1066763017 10:38775032-38775054 CTACAACACTGGGGGAAGGAAGG + Intergenic
1068142582 10:53026418-53026440 CTCAAATACCAGAGAAAGAATGG - Intergenic
1069034490 10:63632375-63632397 CTAAAATTCCAAAGGAAGAAGGG - Intergenic
1070060552 10:72979189-72979211 CTAAAATAACAGAGGAAGTAAGG - Intergenic
1070494738 10:77011112-77011134 CTAACTCACCATAGGAAGGATGG + Intronic
1070920633 10:80183383-80183405 CTGAGATCCCAGAGGAAGGAAGG - Intronic
1071346212 10:84696412-84696434 CTAGAACGCCACAGGATGGAAGG + Intergenic
1071796044 10:89007585-89007607 CTAAAACACAAGGGGAGGGGGGG - Intronic
1072515313 10:96175946-96175968 CTAAAAAACAAAAGAAAGGAAGG - Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1074495639 10:113977936-113977958 CTATAAGCCCAGAGAAAGGATGG - Intergenic
1074718096 10:116238560-116238582 GCAAAACATCAGAGGAAAGATGG - Intronic
1074727898 10:116333043-116333065 CTAGAAAACAAGAGCAAGGAAGG - Intronic
1075592454 10:123702778-123702800 CTGAGGCACTAGAGGAAGGATGG + Intergenic
1075783468 10:125032413-125032435 TCACAAAACCAGAGGAAGGACGG - Intronic
1076223650 10:128756108-128756130 CTCCAGCACCAGAGGAAGGAAGG + Intergenic
1076736409 10:132461112-132461134 CCCAGACTCCAGAGGAAGGAAGG + Intergenic
1076812399 10:132894440-132894462 CTAAAACACTAGCAGAAGGAAGG + Intronic
1078407118 11:11079974-11079996 CTAGACCACTAGAGGAAGAAAGG - Intergenic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1079349381 11:19679870-19679892 CTTAAATACCTGAGGAATGAGGG + Intronic
1079719757 11:23794990-23795012 AAAAAATAACAGAGGAAGGAAGG + Intergenic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1084370668 11:68740530-68740552 CTGAAACAGCAGAGAAAGGAAGG + Intronic
1084380863 11:68811924-68811946 CCAAAACCCTAGAGGTAGGAGGG + Intronic
1084404576 11:68963790-68963812 CCAAAACCCCAGAAGAAGGTGGG - Intergenic
1085761275 11:79243565-79243587 CAGAAACACAAGAGGAGGGAGGG + Intronic
1086205926 11:84258082-84258104 CAACTACACCAGAGGAAGGAGGG - Intronic
1086573822 11:88315213-88315235 CTCAAACAGCAGAGGTGGGAGGG - Intronic
1087021025 11:93603471-93603493 CTTATTCACCACAGGAAGGAAGG - Intergenic
1087885771 11:103480678-103480700 CAAAAACAGAAGAGGATGGAGGG + Intergenic
1089498879 11:118921611-118921633 ATAAAACACCAGGGTTAGGAGGG + Intronic
1089932048 11:122322677-122322699 ACAAAAGGCCAGAGGAAGGAAGG - Intergenic
1090029204 11:123193737-123193759 CTACAACACCAGAGGTTTGAAGG - Intronic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090902205 11:131043080-131043102 CTAAAATAAGAGAGGAAAGAAGG - Intergenic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1091284794 11:134402559-134402581 CTGACACCCCAGAGGAGGGAGGG - Intronic
1091887442 12:4026982-4027004 CCAAAACACAAGAGAAAGTAGGG - Intergenic
1092167890 12:6354297-6354319 CTGAAAAACAAGAGCAAGGAAGG + Intronic
1092490822 12:8943353-8943375 CTTAAAAACAAAAGGAAGGAAGG + Intronic
1092774527 12:11930866-11930888 CTAAAACAGAAGAAGAAGAAAGG + Intergenic
1093521611 12:20057705-20057727 AGAAAACAAGAGAGGAAGGAAGG - Intergenic
1093653520 12:21670989-21671011 CACAAACTCCAGAGAAAGGAAGG + Intronic
1093709195 12:22310265-22310287 ATAAAACACTAGGAGAAGGAAGG + Intronic
1095321746 12:40837293-40837315 CAAAAACACCAAAAGCAGGAAGG + Intronic
1096761550 12:53845815-53845837 CTAAAAGGACAGAGGAAAGAAGG - Intergenic
1098040102 12:66345412-66345434 CTAAGTCACCCGGGGAAGGATGG + Exonic
1101913180 12:108876135-108876157 CTAAACCACAAAAGGAAGGAAGG - Intronic
1102026378 12:109716035-109716057 CTTAAACACCAGAAGGAGCAGGG - Intronic
1102477217 12:113196454-113196476 GGAAAACATCAGTGGAAGGAAGG - Intronic
1104247027 12:127053428-127053450 CTACAGCAAGAGAGGAAGGATGG + Intergenic
1104528466 12:129547072-129547094 CTAGAGCCCCAGAGGAAGCAAGG - Intronic
1104657122 12:130581614-130581636 CAAAGAGAACAGAGGAAGGAAGG - Intronic
1106194205 13:27479669-27479691 GTAGAAGACGAGAGGAAGGAAGG - Intergenic
1106674974 13:31948923-31948945 TTGAAACACAAGGGGAAGGAGGG - Intergenic
1108231928 13:48353907-48353929 CTAAAAAACCTGAGGATAGAAGG + Intronic
1108550614 13:51540017-51540039 CTAAAACCCCTGGGGAAGGAGGG - Intergenic
1108860284 13:54849672-54849694 CTAAATCAACATAGAAAGGAAGG - Intergenic
1109170208 13:59086043-59086065 ATAAGAAACCAGAGTAAGGATGG + Intergenic
1110290117 13:73795852-73795874 CTAACAGATCAGATGAAGGAAGG + Intronic
1113107674 13:106789043-106789065 ATAAAGCCCCAGAGGCAGGATGG + Intergenic
1113781306 13:112979174-112979196 CTACAAACCCAGAGGAAGGGAGG - Intronic
1113824121 13:113237108-113237130 CTAAAACCCCAGTGGCAGGAAGG + Intronic
1114039985 14:18668813-18668835 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1114045019 14:18867336-18867358 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1114119191 14:19652132-19652154 CTTAATCACCAGAGAAAAGAGGG + Intergenic
1114697474 14:24640396-24640418 CTAAAACTCCTGAGGAAATAAGG + Intergenic
1117386693 14:55221377-55221399 CAAAAATACCAGAGGCAGAAAGG - Intergenic
1117810549 14:59541184-59541206 CTATGACACAAGAGGAAGTAAGG + Intronic
1118705818 14:68479352-68479374 AAAAAACAGCAGAGGCAGGAAGG + Intronic
1120557044 14:85940307-85940329 TTAAAACACCAAATTAAGGAAGG + Intergenic
1121008920 14:90508568-90508590 AGAGAACACCAGAGGAAGGCAGG - Intergenic
1202934343 14_KI270725v1_random:71281-71303 CTACAACACTGGGGGAAGGAAGG + Intergenic
1124577171 15:30920061-30920083 CTAAAACAGCAGAGTAAAGTTGG - Intronic
1124686878 15:31790490-31790512 ATAAAAAAGAAGAGGAAGGAAGG + Intronic
1126033066 15:44519742-44519764 CAAAAAAACAAAAGGAAGGAAGG - Intronic
1126897357 15:53273273-53273295 CCAAAGCACCAGGAGAAGGAGGG - Intergenic
1127972361 15:63971564-63971586 GTAAAACACCAGCGGGGGGAGGG + Intronic
1128280307 15:66388519-66388541 CTAAAAATCTAGAGAAAGGAAGG - Intronic
1128485740 15:68085843-68085865 CTCAAACACCAGATGTAGGCAGG - Intronic
1129124387 15:73425874-73425896 GTCAAACACCAGTGGAAGCATGG + Intergenic
1129480570 15:75821843-75821865 ATAAAACCCCAGAGTAAGGTAGG - Intergenic
1130721566 15:86391439-86391461 GGAAAACAGGAGAGGAAGGAAGG - Intronic
1131657570 15:94477482-94477504 CTATAAATCCAGAGGAAGGAGGG + Intronic
1132206387 15:99988808-99988830 CCCAAACAGCAGAGGAGGGAAGG + Intronic
1133311623 16:4851075-4851097 CCAAATCAGCAGAGGAAGGAAGG + Intronic
1133461248 16:5988499-5988521 CTAAGTTCCCAGAGGAAGGAGGG + Intergenic
1135737015 16:24939894-24939916 AAAAAACAGCAGAGGAAGTATGG - Intronic
1137600311 16:49751974-49751996 CCAAAACCCCACAGCAAGGAGGG + Intronic
1137726523 16:50660391-50660413 CTAAAACATCAGAGGGAGCATGG + Intergenic
1138569091 16:57856454-57856476 CTAAAAAAAGAAAGGAAGGAAGG + Intronic
1139020204 16:62739338-62739360 CAGAAACTCCAGAGGAAGCAGGG - Intergenic
1140393135 16:74605642-74605664 CTAGAACACGAGATGAAGGGGGG + Intronic
1140792982 16:78410105-78410127 CAAGAGCAACAGAGGAAGGAAGG - Intronic
1140817588 16:78635308-78635330 CCAAAAAGCCTGAGGAAGGATGG + Intronic
1140819546 16:78650090-78650112 CTGAAATGTCAGAGGAAGGAGGG + Intronic
1141645174 16:85363578-85363600 CACACACAGCAGAGGAAGGAGGG + Intergenic
1142050865 16:87957338-87957360 GTGAAACACCTGAGGAAGGCTGG + Intronic
1145834900 17:27947178-27947200 TTCAACCAACAGAGGAAGGATGG + Intergenic
1146141652 17:30373507-30373529 CTAATATACCAGTGGAGGGATGG - Intergenic
1146498853 17:33347152-33347174 CCAAAACACAAGAGGAGGGGTGG + Intronic
1147029853 17:37623975-37623997 ATAAGAAACCAGAGGAGGGATGG + Intronic
1148646664 17:49223391-49223413 GTAAAACACCAGAGGAAGGAGGG + Exonic
1148712477 17:49691872-49691894 GTGAAAGACCAGAGGAAGGGAGG + Intergenic
1148968793 17:51461499-51461521 CTAAAATACTAGAGGAAGATTGG + Intergenic
1149023178 17:51993816-51993838 ATAAAAGAACAAAGGAAGGAGGG - Intronic
1149514692 17:57271601-57271623 GTAAAAACCCAGATGAAGGAAGG - Intronic
1149905719 17:60525338-60525360 CCAAAACACTCGGGGAAGGAAGG + Intronic
1151458745 17:74242204-74242226 CAAAAAGGCCAGAGGAATGAAGG + Intronic
1153157864 18:2169308-2169330 CTAACACTCCTGAGGAAAGAGGG - Intergenic
1153180920 18:2432209-2432231 TTAAAAGACCAGAGGGAGGGAGG - Intergenic
1155095593 18:22552405-22552427 CCAAAACATCAGAGGAATGTTGG - Intergenic
1155876980 18:31101146-31101168 CTAAATCTTCGGAGGAAGGAAGG - Intronic
1156912667 18:42429035-42429057 CTAGATCACCAGGGGGAGGAAGG + Intergenic
1157271470 18:46279632-46279654 CTAAAACACACCAGGAAAGAAGG - Intergenic
1157418012 18:47521969-47521991 AGAAAACAGCAGAGGCAGGAAGG + Intergenic
1157578421 18:48759105-48759127 CTAAACCTCCAGAAGAGGGATGG + Intronic
1157871166 18:51231328-51231350 CTAAAAGGCCAGACGAAGGTTGG + Intergenic
1157988715 18:52469868-52469890 GTAAAACACCAGTTGGAGGAAGG + Intronic
1158189076 18:54804975-54804997 CTAAAAAAAAAAAGGAAGGAAGG - Intronic
1158239668 18:55362328-55362350 CAAAAAAAAAAGAGGAAGGAAGG + Intronic
1159980182 18:74768952-74768974 CCCAAAGACAAGAGGAAGGATGG - Intronic
1160345476 18:78128601-78128623 CTCAGACAGCAGAGCAAGGAAGG + Intergenic
1163048348 19:14661917-14661939 AAACAACAACAGAGGAAGGAAGG + Intronic
1164801971 19:31084643-31084665 GAGAAACACCAGAGGCAGGAAGG - Intergenic
1165868545 19:38954027-38954049 CTAGAAGACAGGAGGAAGGAGGG + Intronic
1166089898 19:40502105-40502127 CTGACACAGCAGAGGAAGGGGGG - Intronic
1166720515 19:44993363-44993385 CCAAGGCAACAGAGGAAGGAAGG - Intergenic
1167346992 19:48952505-48952527 CTAAAAAACAAAAGAAAGGAGGG - Intergenic
926704210 2:15825392-15825414 CTGACCCAGCAGAGGAAGGAAGG - Intergenic
927210367 2:20635320-20635342 AGAAACCAGCAGAGGAAGGAGGG + Intronic
927582824 2:24269610-24269632 CTAAAGCAGTAGAGGAAGGAAGG - Intronic
927849837 2:26491961-26491983 TTAAAACAACAGAGGGAGGTGGG - Intronic
928139415 2:28715501-28715523 ATAAAAAAACTGAGGAAGGAAGG + Intergenic
928557205 2:32439621-32439643 CTAAAACACCAGAGTAACAAGGG + Exonic
928787558 2:34908067-34908089 AAAAAACACAAGTGGAAGGAAGG + Intergenic
929019595 2:37538497-37538519 CAAAACCACCAGAGAAAAGATGG - Intergenic
929863846 2:45701094-45701116 CTAAGACAGTAGAGGAAGGAAGG + Intronic
930416434 2:51095816-51095838 GTAACACACCAGAGGATGCATGG + Intergenic
931691182 2:64836251-64836273 GAAAAAGTCCAGAGGAAGGATGG + Intergenic
931909826 2:66886868-66886890 CTTAAATACCAGAAGTAGGATGG - Intergenic
933810203 2:86028311-86028333 CTGAAACCCCAAAGGCAGGATGG + Intronic
934132260 2:88959630-88959652 TTAAAACACAGGAGGAAGAAAGG + Intergenic
934464699 2:94250311-94250333 CTACAACACTGGGGGAAGGAAGG + Intergenic
935462696 2:103356731-103356753 AGAAAACAGCAGAGGTAGGAAGG - Intergenic
937053037 2:118907781-118907803 CCAAAGCACCAGGGGAAAGAAGG + Intergenic
937086443 2:119174894-119174916 CTAGAACGGCAGAGGGAGGAGGG + Intergenic
938085525 2:128397778-128397800 CAAAAGCAACAGAGGAAAGATGG - Intergenic
938322719 2:130375720-130375742 ATAAAACACCAGACCAAGGCCGG - Intergenic
939017034 2:136914576-136914598 CGAAAACAGCAGGGGAAAGACGG - Intronic
941581392 2:167300751-167300773 CTAAAATATCAGATGAAGGGAGG + Intergenic
941957302 2:171217955-171217977 TTAAAACAACAGAGTAAGGCCGG + Intronic
945036630 2:205709092-205709114 CTAAGACAGCAGATGGAGGACGG + Intronic
946593376 2:221277091-221277113 CTAGACCACAAGAGGAAGGAAGG - Intergenic
947197153 2:227579709-227579731 CTAAAACATCAGAGAAAAGCAGG - Intergenic
948935145 2:241159005-241159027 TTAACACACCTGAGGAAGGGCGG - Intronic
1171086585 20:22243570-22243592 CTAAAAAGGCAGAGGAAGGGAGG + Intergenic
1171952852 20:31436924-31436946 CTAAAACATGAGTGGGAGGAAGG + Intergenic
1172288587 20:33758693-33758715 CTGAAAGACAAGTGGAAGGAGGG - Intronic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173542029 20:43860949-43860971 CTGAAACATCCGAGGAAAGATGG - Intergenic
1173873128 20:46354053-46354075 CCAAAACATCAAAGAAAGGAAGG + Intronic
1175293339 20:57892837-57892859 CAAAGACACCAGTGGACGGAGGG - Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1176595744 21:8693484-8693506 CTACAACACTGGGGGAAGGAAGG + Intergenic
1178052433 21:28762853-28762875 CTATAACACCATATGACGGATGG - Intergenic
1178818738 21:35955526-35955548 CTGAAACTCCAGAGGGAAGAGGG + Intronic
1179401562 21:41089405-41089427 CTGAAACACCTGTGGAGGGAAGG - Intergenic
1179644380 21:42766746-42766768 CTGAAAAACCAAGGGAAGGAGGG + Intronic
1180278605 22:10670598-10670620 CTACAACACTGGGGGAAGGAAGG + Intergenic
1180463551 22:15589950-15589972 CTTAATCACCAGAGAAAAGAGGG - Intergenic
1181128944 22:20718083-20718105 CTAACCCACGAGATGAAGGACGG - Intronic
1182787596 22:32920515-32920537 GACAAAAACCAGAGGAAGGAGGG + Intronic
1183063077 22:35347273-35347295 CCTTAACACCAGAGGAGGGAGGG - Exonic
1184229976 22:43153138-43153160 CAAAAACAAGAAAGGAAGGAAGG - Intronic
1185148303 22:49150963-49150985 CGAGGTCACCAGAGGAAGGAGGG + Intergenic
1185369520 22:50454611-50454633 CTGAACCCCCAGAGGAAGAACGG - Exonic
949237442 3:1826816-1826838 CAAAAACAAGAGAGGAAGTAAGG - Intergenic
949511228 3:4768817-4768839 CTGAACCATCAGAGGAAGGCAGG - Intronic
949878659 3:8644497-8644519 TTTACACACGAGAGGAAGGAAGG + Intronic
950705366 3:14776218-14776240 CTGAAACACAAGAGGAAGGAGGG + Intergenic
952062865 3:29531649-29531671 CTCAAACACCAAGGGAAGGGCGG - Intronic
953837770 3:46362094-46362116 CAAAAACAAAAGAGGAAGGAAGG - Intergenic
954627808 3:52032141-52032163 ATAAAAGAAGAGAGGAAGGAAGG - Intergenic
955821550 3:62901283-62901305 CCAAAACACCAGAAGCAAGAGGG + Intergenic
956031612 3:65043885-65043907 CTAACACACAAAAGGATGGATGG + Intergenic
956911221 3:73819634-73819656 CCAAAACAGAAGAGGAAGAAGGG - Intergenic
957830977 3:85518603-85518625 TTAAAACTCCAGAGGAAGCGTGG - Intronic
960988122 3:123293418-123293440 CCAAAATCCCAGGGGAAGGATGG + Intronic
961058063 3:123805429-123805451 CCAACACGCCAGAGGAGGGAAGG + Intronic
961210232 3:125119979-125120001 CTAAAACCCCAGAGGCCTGACGG + Intronic
963088921 3:141463883-141463905 CTATAACTACAGAGAAAGGATGG - Intergenic
965360718 3:167735216-167735238 CTGACAGAGCAGAGGAAGGAAGG + Intergenic
965386571 3:168053701-168053723 CTAAATCACCAGAGGTGGGGTGG + Intronic
965817396 3:172651518-172651540 TTAAAAATCCAAAGGAAGGAAGG - Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966645738 3:182244721-182244743 CTAAGAAACAAGAGGAAAGAAGG + Intergenic
968263390 3:197343244-197343266 CTAGGACACCTGAGGAAGGGAGG - Intergenic
969896861 4:10313483-10313505 CTCAAAGACCACAGGAGGGAGGG - Intergenic
971553549 4:27982582-27982604 CCCAAACACCAGAGGCAAGAAGG - Intergenic
975167076 4:71188143-71188165 ATAAGTCACCAGAGGAAGGCAGG + Intronic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
975741105 4:77429729-77429751 CTTAAACACCAGAGACAGGCAGG + Intronic
979980431 4:127248037-127248059 CTAAAGCTGCAGAGGTAGGATGG - Intergenic
980108717 4:128613886-128613908 CTCAGACAACAGAGAAAGGACGG + Intergenic
981049692 4:140297969-140297991 CTACAACCCCAGAGGAATGGAGG - Intronic
987260029 5:16194112-16194134 AGAAAACAGCAGAGGCAGGAAGG - Intergenic
988287165 5:29235142-29235164 GGAAAACAGCAGAGGCAGGAAGG + Intergenic
988492699 5:31718111-31718133 GTAAAAGAGCAGAGGAAGGAAGG + Intronic
988773080 5:34451026-34451048 CTAAAAAACATAAGGAAGGAAGG - Intergenic
989711365 5:44401350-44401372 CTAAAACACCAGTGCAATTAAGG - Intergenic
990835033 5:60008815-60008837 CTAAAACACCAGAGAGAAGTAGG - Intronic
991153536 5:63400858-63400880 CTCAAACACTACAGGAAGAATGG - Intergenic
991522799 5:67519206-67519228 TTAAAACCCCAGGGAAAGGAGGG - Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
992768030 5:80020630-80020652 CTATCACACCAGAGGAAGACAGG - Intronic
992880756 5:81106942-81106964 CCAGACCAGCAGAGGAAGGATGG + Intronic
992969432 5:82041153-82041175 ATAAAACATGAGAGGAATGAAGG - Intronic
994075425 5:95644539-95644561 CTAAAAGAACAAATGAAGGAAGG + Intergenic
994525969 5:100904679-100904701 CTTAAACTCTAGAGGAAGTATGG - Intergenic
994672098 5:102774489-102774511 CTAAAACACTTGTGGGAGGATGG + Intronic
994958502 5:106565905-106565927 CTAAAACACTATAGGAGGAAAGG + Intergenic
995370563 5:111413826-111413848 CTAAAGCACTAGAGAAAGCAAGG + Intronic
996909383 5:128637775-128637797 CTAAGATACCAAAGGAAGGCTGG - Intronic
997098713 5:130943673-130943695 CAAAAACAACAGAAGAAGGGGGG + Intergenic
997223672 5:132192728-132192750 CTAAAACACCTGAGGTACAAAGG + Exonic
997260741 5:132463996-132464018 CTCCAACACCAGATGGAGGAGGG + Exonic
997715907 5:136042635-136042657 AAAAAACAAAAGAGGAAGGAAGG + Intronic
998483396 5:142481335-142481357 CTAAATTATCAGTGGAAGGATGG + Intergenic
999425673 5:151485996-151486018 CTAACACACCAGGGAAAGAATGG - Intronic
999520746 5:152348453-152348475 CTAGGACACCAGAGGAAAAAAGG - Intergenic
1000029627 5:157390621-157390643 CTAAAAGTGCAGAGGCAGGACGG + Exonic
1001466967 5:171976032-171976054 CTAAAACACATGAGGATGGAAGG + Intronic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1002636125 5:180609646-180609668 CAGAAACCCCAGTGGAAGGACGG - Intronic
1002923861 6:1593670-1593692 TTAAAACTCCAGAAGAAGGAAGG - Intergenic
1003569987 6:7249453-7249475 GTAAATGACCAGAGGAAAGATGG + Exonic
1003681968 6:8265682-8265704 CCAAGACATAAGAGGAAGGAAGG + Intergenic
1004009719 6:11671062-11671084 CTAAAACAGAAGAGAAAGAAAGG + Intergenic
1005564896 6:27081300-27081322 GAAAAATATCAGAGGAAGGAAGG - Intergenic
1005820681 6:29596103-29596125 CCTAAACTCCAGAGGAAGGAGGG - Intronic
1005948490 6:30613424-30613446 CTAAAACACTGAAGAAAGGAAGG - Intronic
1007930884 6:45689756-45689778 CAAAAAAAGAAGAGGAAGGAAGG - Intergenic
1009655488 6:66539716-66539738 CTAAAAGCCCAGAGTAAGCAGGG - Intergenic
1011053888 6:83185042-83185064 CTAAAACACTAGAAGAGTGATGG + Intronic
1011366743 6:86590646-86590668 CTATAACAGCAGGTGAAGGAAGG + Intergenic
1011724630 6:90197740-90197762 TTAAAACTCCTGATGAAGGACGG + Intronic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013490814 6:110644750-110644772 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013491208 6:110647342-110647364 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013540387 6:111102623-111102645 CTAAGACAGCAGAGGAAACAAGG - Intronic
1013849485 6:114496691-114496713 CTAAACTATCGGAGGAAGGAAGG - Intergenic
1014483672 6:121971957-121971979 ATAAAATACCAGAAGAAGCAGGG - Intergenic
1014488382 6:122030080-122030102 ATAATACACCAAAGGATGGAAGG + Intergenic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1015746683 6:136517276-136517298 CTAAAACAACACAAGAAAGAAGG + Intronic
1017126212 6:151066816-151066838 CTAAAGCATCAGCGAAAGGATGG - Intronic
1017451993 6:154562933-154562955 CTCAACCACCAGAGGCAAGATGG + Intergenic
1017590972 6:155977633-155977655 CTGAAACAGTAGAGGAAGAAAGG + Intergenic
1018982216 6:168610198-168610220 CTAAAACAGGAGGAGAAGGATGG + Intronic
1019486743 7:1292901-1292923 GTAAAACCCCAGGGGAAGTAAGG - Intergenic
1019630681 7:2047354-2047376 ATAAAACACCAAGGGGAGGAAGG - Intronic
1020183895 7:5943958-5943980 GTAAAACACAAGAAGAGGGATGG + Exonic
1020299022 7:6780819-6780841 GTAAAACACAAGAAGAGGGATGG - Exonic
1021231954 7:18095575-18095597 ATAAAACACCACAGGAAGAATGG + Intronic
1021551409 7:21874819-21874841 CCAAAAAATTAGAGGAAGGAAGG - Intronic
1023184979 7:37523808-37523830 CAACAACAAAAGAGGAAGGAAGG - Intergenic
1023412327 7:39900480-39900502 CAAAAACATCAGAAGAATGATGG + Intergenic
1026476486 7:70740394-70740416 CTGAAGCAGCAAAGGAAGGAAGG - Intronic
1026593825 7:71717728-71717750 CTCAGACACCAGATGAAAGAAGG + Intergenic
1028241232 7:88423623-88423645 CAAAAACAACATAGGAAGTATGG - Intergenic
1029368457 7:100131870-100131892 CTAAAAAAAGAAAGGAAGGAAGG - Intergenic
1030632521 7:111911455-111911477 TTAAAAAGCCAGAGGAAGAAAGG + Intronic
1030915457 7:115306594-115306616 ATAAAACACCAGATTAATGAAGG + Intergenic
1031306506 7:120133458-120133480 CTAAAAAAATACAGGAAGGAAGG + Intergenic
1031824257 7:126543354-126543376 CAGAATCACTAGAGGAAGGAGGG - Intronic
1032716719 7:134515144-134515166 ATACAACAGCAGAGGATGGAGGG - Intergenic
1033454894 7:141493777-141493799 CTAGAAGACCAGGTGAAGGAAGG - Intergenic
1035658134 8:1326833-1326855 CTACAACACCAAAGGGAGGAAGG - Intergenic
1035945111 8:3953975-3953997 CATCACCACCAGAGGAAGGAAGG - Intronic
1036785655 8:11684191-11684213 CCATAACATCAGAGGAAGGTTGG - Intronic
1038215420 8:25557693-25557715 CTTATAGACCAGAGGAAGAAGGG + Intergenic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1039852668 8:41383793-41383815 CTAACAGAGCAGAGGAAGGATGG + Intergenic
1041930902 8:63285209-63285231 CTACAAAAACAAAGGAAGGAGGG - Intergenic
1042586623 8:70346686-70346708 CGAAAATACCAGTGGAAGGGAGG + Intronic
1042823486 8:72957037-72957059 CTAAAAAAGGAAAGGAAGGAAGG + Intergenic
1045683943 8:104691850-104691872 CTAAAATAAGAGAGAAAGGACGG + Intronic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1046584353 8:116133199-116133221 CTAAAACACCACATGAAACAAGG + Intergenic
1046750677 8:117923316-117923338 CAAAAACACAAAAAGAAGGAAGG + Intronic
1047237194 8:123052224-123052246 CTAAAACAGAAGAGAAAGGGAGG + Intronic
1048489189 8:134876430-134876452 CTAAAACAAGAGTGGTAGGAAGG - Intergenic
1048704156 8:137131661-137131683 CTGTAACACTAGAGGAAGGTAGG - Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050097907 9:2086806-2086828 CTATAACACAAGAGGAAGGACGG - Intronic
1050465314 9:5916667-5916689 CTAACACACCAGAAGGAGGCAGG + Intronic
1051189737 9:14498842-14498864 CTAAGAAAGCAAAGGAAGGAAGG - Intergenic
1051325375 9:15960985-15961007 CTAAAACAGCAGTGGAAGGGAGG + Intronic
1051418765 9:16870609-16870631 CTAGAATAAAAGAGGAAGGAGGG + Intronic
1051605122 9:18910981-18911003 ATAAACCACCAGGGGAAGGAAGG - Intergenic
1052822002 9:33144940-33144962 CTAAAACATCAAAGGCAAGATGG - Intronic
1053694789 9:40627076-40627098 CTACAACACTGGGGGAAGGAAGG + Intergenic
1053799298 9:41754436-41754458 CTGAAACACCACTGGAAAGAAGG + Intergenic
1054187707 9:61966495-61966517 CTGAAACACCACTGGAAAGAAGG + Intergenic
1054270052 9:63013046-63013068 CTACAACACTGGGGGAAGGAAGG - Intergenic
1054306033 9:63426300-63426322 CTACAACACTGGGGGAAGGAAGG + Intergenic
1054404775 9:64750276-64750298 CTACAACACTGGGGGAAGGAAGG + Intergenic
1054438399 9:65235768-65235790 CTACAACACTGGGGGAAGGAAGG + Intergenic
1054492005 9:65786180-65786202 CTACAACACTGGGGGAAGGAAGG - Intergenic
1054650809 9:67622086-67622108 CTGAAACACCACTGGAAAGAAGG - Intergenic
1054989223 9:71302780-71302802 CTAAAAAAAAAAAGGAAGGAAGG + Intronic
1056259499 9:84833706-84833728 CTAAAATACAAGAGTAAGAATGG - Intronic
1059222267 9:112634903-112634925 ATAAAACAATAAAGGAAGGAAGG - Intronic
1059343106 9:113610620-113610642 TTAAATCACCAGACGAGGGAAGG - Intergenic
1059520208 9:114933729-114933751 GTAAAACACGAGAGGAAGCCTGG - Intergenic
1061260451 9:129477752-129477774 CAAAAACAACAAAGAAAGGAAGG - Intergenic
1062386781 9:136315426-136315448 CTAAAATAACAGAGGCTGGAGGG + Intergenic
1062615064 9:137392622-137392644 CTAAAGCAGCACAGAAAGGATGG + Intronic
1202777234 9_KI270717v1_random:679-701 CTACAACACTGGGGGAAGGAAGG + Intergenic
1186809099 X:13169414-13169436 CAAAAACAGCAGAGCAAGGATGG - Intergenic
1187257983 X:17658568-17658590 CTAGAAGACTAGAGGAATGATGG - Intronic
1188488544 X:30710732-30710754 CCAAATCAGCAGAGGAAGAATGG - Intronic
1188550789 X:31362646-31362668 ATAAAACAACAGAGTAAGGCCGG + Intronic
1189377844 X:40479691-40479713 ATAAAAGAGCAAAGGAAGGAGGG - Intergenic
1190365453 X:49689413-49689435 TGAAAACACCTGAGGAAGGTAGG - Exonic
1192137768 X:68620403-68620425 CAAAAAGAAAAGAGGAAGGAAGG - Intergenic
1194180731 X:90708673-90708695 CTAGACCACTAGAGGGAGGAGGG - Intergenic
1194396857 X:93396320-93396342 TCAAAACAACAGAGAAAGGAGGG - Intergenic
1195266063 X:103181071-103181093 CAAATAAACCAAAGGAAGGATGG - Intergenic
1196553150 X:117054548-117054570 CTAAGACTGCAGAGGCAGGAAGG - Intergenic
1197320971 X:125030229-125030251 CTAAAACATCCGAAGAAGGTCGG + Intergenic
1197701619 X:129604360-129604382 CCAAAACTCGAGAGAAAGGAGGG + Intergenic
1198676493 X:139136815-139136837 CAAAAACCCCAGAGGAAAGCAGG + Intronic
1198706233 X:139451461-139451483 CAAAAACACCTGAGGGAGAAAGG + Intergenic
1199465403 X:148129933-148129955 CTAAATATCCAGAGGAAGGGAGG + Intergenic
1199767000 X:150948590-150948612 AAAAAAAACCAGAGGAAAGAGGG + Intergenic
1200527394 Y:4290829-4290851 CTAGACCACTAGAGGGAGGAGGG - Intergenic
1201403103 Y:13624278-13624300 CCTAAACACCAAAGGGAGGAGGG - Intergenic
1201491809 Y:14549834-14549856 CTAATACTCCCTAGGAAGGAAGG + Intronic
1202169804 Y:22031398-22031420 CTAAAACAGGAGACAAAGGATGG - Intergenic
1202221562 Y:22554975-22554997 CTAAAACAGGAGACAAAGGATGG + Intergenic
1202321556 Y:23640697-23640719 CTAAAACAGGAGACAAAGGATGG - Intergenic
1202549211 Y:26029359-26029381 CTAAAACAGGAGACAAAGGATGG + Intergenic