ID: 1013491543

View in Genome Browser
Species Human (GRCh38)
Location 6:110651087-110651109
Sequence CAGGCAAAGGGTTGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 596}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013491535_1013491543 -7 Left 1013491535 6:110651071-110651093 CCGGAAATCAAGAGCTCAGGCAA 0: 1
1: 0
2: 0
3: 44
4: 332
Right 1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG 0: 1
1: 0
2: 7
3: 60
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013491543 Original CRISPR CAGGCAAAGGGTTGGGAAGG GGG Intronic
900288688 1:1914639-1914661 CAGGCAGAGGGTTGGGCTGGCGG + Intergenic
900467308 1:2832057-2832079 CATGCAGAGGGATGGGAGGGTGG + Intergenic
900611562 1:3546634-3546656 GTGGCAATGGGCTGGGAAGGGGG + Intronic
900631601 1:3639382-3639404 CAGGGAAAGGGGTGGAAAAGTGG - Intronic
900939204 1:5786942-5786964 CAGGGAAAAGGTGGGGACGGGGG + Intergenic
901634481 1:10664246-10664268 CGGGCACAAGGCTGGGAAGGAGG + Intronic
901634619 1:10664828-10664850 CAGGCAGAGGGGTGGACAGGTGG - Intronic
901889860 1:12253398-12253420 CAGGCAAATGGTCGGGTAGGAGG - Intronic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902291770 1:15440228-15440250 CGGGGAAAGGGGTGGGAGGGTGG - Intronic
902336696 1:15758535-15758557 CAGGCCAGGGGGTGGGAATGGGG - Intronic
903365665 1:22804229-22804251 CAGGCACAGTGCTGGGCAGGAGG - Intronic
903573540 1:24323424-24323446 CAGGCAGAGGACTGGGAAGCAGG + Intronic
903848864 1:26294449-26294471 CAGACAAAGGGATGAGTAGGGGG + Intronic
904441022 1:30530877-30530899 CAGGAAAAGGATGGGCAAGGGGG - Intergenic
904630854 1:31841000-31841022 AAGGCTCAGGGTTGGGAAAGAGG + Intergenic
905921543 1:41722553-41722575 CAGGCAGAAGGAAGGGAAGGAGG - Intronic
907886009 1:58592980-58593002 CAGGGATAGGTATGGGAAGGGGG - Intergenic
908213116 1:61921783-61921805 CAGGGGAAGAGGTGGGAAGGAGG + Intronic
909538064 1:76760516-76760538 CAGGAAAGGGGTTGGGAGAGTGG + Intergenic
910081612 1:83348478-83348500 CAGGCACAGGGTAGGTAAGATGG - Intergenic
910444977 1:87290969-87290991 GAGGCAGAGAGTTAGGAAGGAGG + Intergenic
912283850 1:108347211-108347233 CAGGAAAAGGGAGAGGAAGGGGG - Intergenic
912417721 1:109521442-109521464 AAGACAAAGGGCTGGGAAGAGGG - Intergenic
912511584 1:110193647-110193669 CAGGGAAAGGGTTGGGGTGTAGG - Intronic
912583693 1:110742537-110742559 CGGGCAGAGGCTTGGGAAGTGGG + Intergenic
913133393 1:115863583-115863605 CAGGTAAAGGTTTGGGGATGTGG + Intergenic
915254376 1:154614804-154614826 GAGGCAAAGGGGTAGGATGGAGG + Intronic
915311380 1:155007432-155007454 CAAGCAAATGCTTGGGCAGGGGG + Intronic
915603154 1:156935175-156935197 CAGGGACAGGGTGGGGAAGAGGG + Exonic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915913147 1:159926459-159926481 CAGGTAAAGGGTAGAGCAGGTGG - Intergenic
917217712 1:172695228-172695250 TAGGTATAGGGTTGGGCAGGGGG + Intergenic
918238833 1:182604221-182604243 CAGGCAGGTGGTGGGGAAGGCGG + Exonic
920074280 1:203325465-203325487 CAGGCTAGGGGTGGGGAGGGAGG - Intergenic
920279043 1:204829368-204829390 CAGCCAAAGGGGGGAGAAGGCGG - Intronic
920550350 1:206855438-206855460 CAGGTCAAGGGTGGGGAGGGCGG + Intergenic
921522142 1:216168905-216168927 CTGGTAAGGGGTTGGGAAGTGGG - Intronic
922070057 1:222183474-222183496 CAGGGAAAGGGGTGGGATTGTGG - Intergenic
922123102 1:222694422-222694444 GAGGCAAAGGGTTGGGATGAGGG + Intronic
922518158 1:226223604-226223626 CGGGCCAGGGGCTGGGAAGGCGG - Exonic
923755960 1:236791440-236791462 CAGGCACAGGGTGGGGGTGGGGG - Intergenic
924534567 1:244923877-244923899 TGGGCAGTGGGTTGGGAAGGTGG - Intergenic
1063081290 10:2770145-2770167 CGGGGGAAGGGGTGGGAAGGGGG + Intergenic
1063689827 10:8276165-8276187 CTGGCAAAGAGAAGGGAAGGTGG + Intergenic
1064106209 10:12502751-12502773 AAGGCAGAGCGCTGGGAAGGAGG + Intronic
1065610385 10:27466368-27466390 CAGGCAAAGGGAGAAGAAGGAGG - Intergenic
1065664019 10:28039013-28039035 CGGGGAAAAGGGTGGGAAGGGGG - Intergenic
1065828684 10:29595285-29595307 CAAGGACAGGGTTGGGCAGGTGG + Intronic
1066706329 10:38183042-38183064 CAGGGAAAAGGGTGGGAAGGGGG - Intergenic
1067115350 10:43431637-43431659 CAGGAAAAGTTTTGGTAAGGCGG - Intergenic
1067376904 10:45735814-45735836 CTGGCAAAGGTTTGGGTAAGGGG + Intronic
1067884603 10:50076530-50076552 CTGGCAAAGGTTTGGGTAAGGGG + Intronic
1068103976 10:52591254-52591276 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1068279470 10:54850434-54850456 CAGGGGAAAGGTTGGGAAGTGGG - Intronic
1069632101 10:69903198-69903220 CAGGCAGTGGGTTCTGAAGGAGG + Intronic
1069633903 10:69913855-69913877 CAAGCAAGGGGGTGGGAGGGAGG + Intronic
1069777350 10:70934793-70934815 CAGGAAAGAGGCTGGGAAGGCGG - Intergenic
1069952010 10:72025505-72025527 CAGGATCAGGGTTGCGAAGGAGG + Intergenic
1070319327 10:75343057-75343079 CAGGCAAAATGGGGGGAAGGAGG + Intergenic
1070604213 10:77887257-77887279 CAGGCAAAGGGCTGGGAGGTGGG - Intronic
1070650483 10:78231962-78231984 TAGGTACAGGGGTGGGAAGGTGG - Intergenic
1070732592 10:78841695-78841717 AAGGCAAAGGGTGGGGAGAGAGG + Intergenic
1070739685 10:78894548-78894570 CAGGCAGAGGATGTGGAAGGGGG + Intergenic
1070761210 10:79025411-79025433 AAGGCACAGGGTTGGGGGGGCGG + Intergenic
1070957404 10:80473532-80473554 CTGGCACAGTGTGGGGAAGGTGG - Intronic
1070960035 10:80492275-80492297 AATCCAAAGGGTTGGGCAGGGGG - Intronic
1071957995 10:90779908-90779930 CAAGAAAAGGGTTGGGGATGGGG - Intronic
1072380169 10:94859576-94859598 AAGGGAGATGGTTGGGAAGGTGG + Intergenic
1072744994 10:97933586-97933608 CAGGCAGAGGATTGGGAGAGGGG + Intronic
1073052227 10:100674757-100674779 CAGGCAAGGGGCAGGGCAGGAGG + Intergenic
1073116418 10:101094260-101094282 GAGGCACAGGGTTGGTATGGGGG - Intronic
1073935996 10:108632544-108632566 GAGGCAAAGGGCTGGGAAGGAGG + Intergenic
1075132777 10:119754699-119754721 CATGGAGAGGGTTGGGAGGGAGG - Intronic
1075338662 10:121627767-121627789 CAGGCAGAGTGAGGGGAAGGAGG - Intergenic
1075605005 10:123798425-123798447 CAGGCAAAGTTTTGGGGAAGAGG + Intronic
1075849475 10:125575378-125575400 GAGGGAATGGGTTGGGGAGGTGG - Intergenic
1076372971 10:129966906-129966928 CAGGCCAGGGATGGGGAAGGGGG + Intergenic
1076550051 10:131272563-131272585 CAGGCACAGGGCTGGTAGGGAGG - Intronic
1076776965 10:132703277-132703299 CGGGCACAGGGTTGTGCAGGAGG - Intronic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078151204 11:8761005-8761027 GAGGAGGAGGGTTGGGAAGGAGG - Intronic
1078350601 11:10590019-10590041 CAGGCCTAGAGTTGGGAAAGGGG + Intronic
1078356401 11:10635271-10635293 CAGTCAAGGGGGTGGGAAGGAGG - Intronic
1079560062 11:21811080-21811102 CAGGCATGGGGGTGGGCAGGAGG + Intergenic
1080486363 11:32711606-32711628 CAGGCAAAAGGCTGGGAGAGGGG + Intronic
1080696766 11:34609623-34609645 AGGGCATAGGGTTGGGAATGTGG - Intergenic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1082028255 11:47587871-47587893 TAAGCTCAGGGTTGGGAAGGGGG + Intronic
1082085748 11:48048185-48048207 CAAGCAAAGGCAAGGGAAGGAGG - Intronic
1084055584 11:66630206-66630228 TAGGCAAATGGTAGGTAAGGAGG + Intronic
1084582251 11:70031492-70031514 GAGGCAAGGGGATGGGAAAGAGG - Intergenic
1084856861 11:71994983-71995005 GTGGGAAAGGGTAGGGAAGGTGG - Intronic
1084872147 11:72105557-72105579 CAGGCAGAGGGTAGGGGTGGGGG + Intronic
1085070543 11:73540510-73540532 AAGGCAATTGGTTGGGCAGGAGG - Intronic
1085267006 11:75242993-75243015 GAGCCAAAGGCTTGGGCAGGAGG - Exonic
1086898026 11:92335981-92336003 CAGGCAAGGGGTGGGGAAGGTGG + Intergenic
1087969558 11:104462490-104462512 CACGCAAGGGGTTGGGGAGTGGG + Intergenic
1088030435 11:105242104-105242126 CAAGCAAATGGTTGTGATGGTGG + Intergenic
1088746189 11:112806894-112806916 CAGGGAAAGGGTTAGGCAGCTGG + Intergenic
1088928926 11:114329477-114329499 AGGGCAAAAGGGTGGGAAGGGGG + Intergenic
1089190895 11:116652551-116652573 AAGGTAAAGGGGTGGGAAGTGGG - Intergenic
1089293713 11:117455341-117455363 CAGGCAAAGGGTGGGTAATGAGG - Intronic
1089456334 11:118628023-118628045 CACGGAAAGGGCTGGGAGGGCGG - Exonic
1089661887 11:119991285-119991307 CAGGCAGAGGGAAGGGAAGTTGG + Intergenic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1089750993 11:120651046-120651068 CAGGGAAAGCTTTGGGAATGGGG + Intronic
1089809535 11:121120469-121120491 CAGGGAGAGGGCTGGGAAGCAGG + Intronic
1090595614 11:128318191-128318213 CAGGGAGAAGGGTGGGAAGGGGG - Intergenic
1091088333 11:132745657-132745679 CAGGGAAGTGGTTGGGAAGATGG - Intronic
1091239841 11:134045002-134045024 CAGGGAAGGCTTTGGGAAGGAGG + Intergenic
1091273473 11:134333610-134333632 CAGGAAAAGGTATGCGAAGGAGG + Intronic
1091710110 12:2733918-2733940 CAGGCAAGGGGTCGGGGTGGGGG - Intergenic
1091799035 12:3313212-3313234 CACGCAAAGTGTTTGCAAGGGGG - Intergenic
1091813742 12:3420614-3420636 GAGGCAGTGGGTTGGGAGGGTGG + Intronic
1092077021 12:5682412-5682434 TAGGCAAAGGGTGGGGAATATGG + Intronic
1092877220 12:12858787-12858809 GAGGCAAAGGGATGGGGAGGAGG - Intergenic
1093163498 12:15777768-15777790 GAGGAAAAGAGTTGGGAAAGGGG + Intronic
1094375254 12:29783128-29783150 CAGGCGAAGGGGTGCGGAGGCGG + Intronic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1095166073 12:38973625-38973647 GAGGGAGAGGGTTGGGAAGATGG - Intergenic
1095252781 12:39998379-39998401 GAGGGAAAAGGGTGGGAAGGGGG + Intronic
1095613791 12:44164354-44164376 CAGGGGAAGGGGTGGGATGGTGG - Intronic
1095957903 12:47817197-47817219 CAGGCCAAGGCTGGAGAAGGAGG - Intronic
1096183356 12:49563413-49563435 AAGGCTGAGGGCTGGGAAGGTGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097181395 12:57173995-57174017 CAGGAGAAGGGTAGGGAGGGTGG + Intronic
1097187594 12:57204036-57204058 CAGGCACAGGGATGGGAACCCGG + Intronic
1097313209 12:58143873-58143895 CTAGCAAAGGGTTGGAAATGTGG - Intergenic
1098572648 12:72006377-72006399 AAGGAACAGGGTTGGGGAGGTGG + Intronic
1099055311 12:77833111-77833133 CAGAAAAAGAATTGGGAAGGAGG - Intronic
1099198325 12:79646167-79646189 AAGGCAAAGGGAAGGGATGGGGG + Intronic
1100212097 12:92408236-92408258 CACACAAAGGGTTGGTAGGGTGG - Intergenic
1100953743 12:99882639-99882661 GCGGGAAAGGGTGGGGAAGGGGG + Intronic
1101027859 12:100631158-100631180 CAGGTGAAGAGTTGGGATGGGGG - Intergenic
1101347702 12:103901696-103901718 CAGGCAAAGGGTGTGGGAGTCGG + Intergenic
1101601869 12:106216663-106216685 AATGCAAAGGGGTGGAAAGGAGG - Intergenic
1101806577 12:108069472-108069494 CAGGCAAAGTGCTTGGATGGCGG - Intergenic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1103023222 12:117553471-117553493 TGGGAAATGGGTTGGGAAGGGGG + Intronic
1103248784 12:119481748-119481770 AAGGGAAAGGGGTGGGAAGGAGG - Intronic
1103256883 12:119549248-119549270 CGGGAACAGGGGTGGGAAGGAGG + Intergenic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1105032326 12:132892543-132892565 CAGGCCTTGGGTTGGGAAGAAGG - Intronic
1105322877 13:19345209-19345231 CAGTCAGAGGTTTGGGAATGGGG + Intergenic
1106402676 13:29444890-29444912 CAGGCAAAGGCAAAGGAAGGAGG - Intronic
1106487897 13:30188784-30188806 CTGGTAAAGGGCTGGGAAGATGG + Intergenic
1107112890 13:36716826-36716848 CAGGCAAGGAGTTGGGAAAGGGG - Intergenic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107671658 13:42752637-42752659 CAGGCTAAAGGGTGGGAATGTGG - Intergenic
1107736079 13:43399876-43399898 CAAGCAGAGGGTTGGAAAGATGG - Intronic
1108156387 13:47589698-47589720 CAGGAAAAGGGATGGGGAGTTGG + Intergenic
1108508559 13:51135017-51135039 CAGGCAAGGGGTGGGAGAGGAGG - Intergenic
1108512852 13:51171144-51171166 CAGGCTAAGGGAGGAGAAGGAGG - Intergenic
1108587825 13:51886128-51886150 AAGGTAATGGTTTGGGAAGGTGG + Intergenic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1110011454 13:70339738-70339760 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1110364828 13:74670029-74670051 GAGGGAAAGGGGAGGGAAGGAGG - Intergenic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1112018950 13:95354928-95354950 CAGGCTGAGGGTTGGGAGGCTGG - Intergenic
1112632902 13:101181253-101181275 CAGGCAGAGGGTTTGGAGGCTGG + Intronic
1113322938 13:109254542-109254564 CAGGAAAAGGGTTCAGAAGCAGG - Intergenic
1113943700 13:114032469-114032491 CAGGCAAGGGTTTCAGAAGGTGG - Intronic
1114206286 14:20574287-20574309 CTGGGAAAGGGTGGGAAAGGAGG + Intergenic
1114415134 14:22537824-22537846 CAGGCAAAGATTTGGGACAGTGG - Intergenic
1116585441 14:46697441-46697463 CAGGCAGGGGCTTGGGAAGAGGG - Intergenic
1118314276 14:64716112-64716134 CAGGCCAGGGGATGGGAATGGGG + Intronic
1119543621 14:75456567-75456589 CAGGCAAAGAGAGGGAAAGGGGG - Intronic
1119612421 14:76074869-76074891 CTGACAATGGGTTGGGGAGGGGG - Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1121572371 14:94956622-94956644 CAGGCACCTGGTTGGGGAGGGGG + Intergenic
1122219764 14:100230015-100230037 CAGGCAATAGGTGGTGAAGGAGG + Intergenic
1122560707 14:102612264-102612286 GAGGCCAAGGTTTGGGAAGAGGG - Intronic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124700371 15:31907262-31907284 GAGGCTAGGGGTTGGGAATGGGG + Intergenic
1125087267 15:35745076-35745098 AAGACAAAGGGTAGAGAAGGTGG + Intergenic
1125155476 15:36579978-36580000 CAGGCAAAGGGCTGTGAGAGGGG - Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125973171 15:43928712-43928734 CAGGCAAAGGGAAGGGAAGACGG - Intronic
1126166582 15:45658954-45658976 CAGGCAAAGAGCTGGGCACGGGG - Exonic
1126700869 15:51366435-51366457 AAGGGAAAGGTTTAGGAAGGTGG + Intronic
1127226459 15:56935622-56935644 CAGGGAAAAGGGTGGGAGGGCGG - Intronic
1127545262 15:59988000-59988022 CAGGTTAAGGGTGGGGAAAGAGG + Intergenic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127920902 15:63493398-63493420 GAGGAAGAGGGTAGGGAAGGAGG + Intergenic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128233162 15:66049324-66049346 CAGGAAAAGGGTTGGGGTAGGGG + Intronic
1128264582 15:66254906-66254928 AAGGCCCAGGGTTGGAAAGGTGG + Intergenic
1128450144 15:67801226-67801248 AAGGCAAAGGGATGGGCAGTGGG + Intronic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1128674725 15:69600164-69600186 CAGGCAGAGGGGTGGGAGGGGGG + Intergenic
1128913482 15:71538328-71538350 AAGGCAAAGGGTTGGGAATGTGG - Intronic
1129208304 15:74050486-74050508 CAAGCACAGGGATGAGAAGGTGG - Intergenic
1129794923 15:78368887-78368909 CAGGCAGAGGTATGGGAAGTGGG + Intergenic
1130311831 15:82763039-82763061 CAAGCAAAGCTTTGGGAAGGAGG + Intronic
1130328523 15:82901295-82901317 CAGGCAAAGGGGTGCAGAGGAGG + Intronic
1132266017 15:100471399-100471421 CAGTGAAAGGGTGGGGAGGGTGG + Intronic
1132908355 16:2295824-2295846 CAGGCAAGCTGGTGGGAAGGAGG + Intronic
1133114001 16:3565603-3565625 GGGGCCAAGGGTTGGGGAGGAGG + Intronic
1133362331 16:5184376-5184398 CAGGTAAAGGCTTGGGAAGTGGG + Intergenic
1134118000 16:11563846-11563868 AAGACAAAGGGTTGGGGTGGGGG + Intronic
1134386378 16:13777327-13777349 CAGGCATAGGCTTGGGAAGCAGG - Intergenic
1134862778 16:17575504-17575526 CAGGTACAGGGTGGGGTAGGGGG - Intergenic
1135191408 16:20357735-20357757 CAGGGATGGGGGTGGGAAGGTGG + Intergenic
1136296856 16:29308838-29308860 CAGGCAGAGGGATGGGCAGAGGG - Intergenic
1137689691 16:50414353-50414375 AAGGGAAAGGGTTGGTGAGGAGG - Intergenic
1137697222 16:50469379-50469401 CAGGCCAAGTGTGGAGAAGGAGG - Intergenic
1138028626 16:53541756-53541778 CATGCAATTGGCTGGGAAGGTGG + Intergenic
1138489724 16:57369725-57369747 CAGGCAATGTGGTGGGATGGGGG - Intergenic
1139261476 16:65598697-65598719 CAGGCCTAGGGTTGGGGTGGGGG + Intergenic
1139310154 16:66021311-66021333 CAGGGAAGGTATTGGGAAGGTGG - Intergenic
1139640457 16:68287868-68287890 CAGGGTAAGTGGTGGGAAGGGGG + Exonic
1139671001 16:68492527-68492549 CAGCCACAGGGTTGGGGTGGGGG + Intergenic
1140457188 16:75112350-75112372 CAGGCAAAGTGCTGTGAAGGGGG - Exonic
1141412710 16:83846284-83846306 CTGGCAAAGGGAAGGGAAGACGG + Intergenic
1141523868 16:84598887-84598909 CAGTCAAAGGGATGGGGATGTGG + Intronic
1141592781 16:85079625-85079647 CGGGCAGAGGGTGGGGAATGGGG + Intronic
1141747927 16:85938507-85938529 CAAGGAAAGGGGTGGGAAAGAGG - Intergenic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142069964 16:88086706-88086728 AAGGCAAAGGGAAGGGAAGTGGG - Intronic
1142767002 17:2070460-2070482 CAGGCACAGGGCTGGGGAAGTGG + Intronic
1143317788 17:6045830-6045852 CAGGAGGAGGGTTGGCAAGGAGG - Intronic
1143544986 17:7590428-7590450 CAGGAAAGGGGTTGGGGTGGTGG - Intronic
1143719326 17:8799007-8799029 CAGGTAAAGGGTCAGGAACGGGG + Exonic
1144783497 17:17819505-17819527 CTGGCCAGGGGTTGGGGAGGGGG - Intronic
1144826712 17:18109258-18109280 CTGGCAAAGGGTGGGAAATGAGG + Intronic
1145080809 17:19892887-19892909 CAGGCTAAGGGAGGAGAAGGGGG + Intergenic
1145784535 17:27585551-27585573 CAGGCAAGGGGCTGGGACGTAGG - Intronic
1145861744 17:28216932-28216954 CAGGCAGGGGGTTGAGGAGGAGG + Intergenic
1146162425 17:30567090-30567112 CCGGCAGAGGGATGGGATGGAGG - Intergenic
1146728023 17:35171295-35171317 AAGGCACAGGGTTGGGGAGAGGG - Intronic
1147303642 17:39548884-39548906 CAGGCATGGGGGTAGGAAGGAGG - Intronic
1147482905 17:40783899-40783921 AAGGCAAAGAGATGGGAAAGAGG - Intergenic
1147606626 17:41777347-41777369 CAGGGACAGAGTGGGGAAGGTGG - Intronic
1147669325 17:42167691-42167713 TAGGCCAAGGGTGGGGATGGAGG - Intronic
1148083407 17:44979886-44979908 CAGGCCAGGGTGTGGGAAGGGGG - Intergenic
1148324770 17:46776875-46776897 AAGGCAACGGGAGGGGAAGGAGG - Intronic
1148480971 17:47959178-47959200 CAGGCAAAGGGTGAGGCACGGGG + Intergenic
1148553926 17:48566540-48566562 ATGGAAAAGGGTTGGGGAGGAGG + Intronic
1149103746 17:52937319-52937341 CAGGTAGAGGCTTGGGAAGTAGG - Intergenic
1149187568 17:54017437-54017459 CTGGCAAAGGGAAGGGAAGATGG - Intergenic
1149662191 17:58339784-58339806 AAGGCAGAGGGTTGAGAATGGGG + Intergenic
1149751797 17:59153710-59153732 CAGGGAATGGCGTGGGAAGGAGG + Intronic
1150075035 17:62185064-62185086 CAGGCTAATGGTTTGTAAGGAGG + Intergenic
1150218695 17:63484017-63484039 CTGGCAAAGGGTGTGGCAGGAGG + Intergenic
1151511211 17:74561402-74561424 CAGGTAGAGGGCTGGGAAGGTGG - Intergenic
1152482623 17:80565373-80565395 AAGGCAAAGGGAAGGGGAGGTGG + Intronic
1152596396 17:81239701-81239723 GAGGGGAAGGGCTGGGAAGGGGG - Intronic
1152675174 17:81636602-81636624 CGGGAAACGGGTGGGGAAGGAGG + Intronic
1152800239 17:82327434-82327456 CAGGCACAGGGAAGGGAAGGAGG - Intronic
1156146959 18:34194397-34194419 TAGGAAAAAGGTAGGGAAGGAGG + Intronic
1156526881 18:37776159-37776181 CAGGCAGAGAGGTGGGAAGGAGG + Intergenic
1156849346 18:41708113-41708135 CAGAAAAAGGGGTGGGGAGGGGG + Intergenic
1157078716 18:44497916-44497938 CAGGCTAAGCTCTGGGAAGGAGG + Intergenic
1157171386 18:45409633-45409655 CTGGGAAAGGGGTGGGTAGGAGG - Intronic
1158093220 18:53739873-53739895 GAGGCAAAGGGTTGGGTAAGTGG - Intergenic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1160010564 18:75104553-75104575 CAGGCACCGGGTTGAGCAGGCGG - Intergenic
1160046532 18:75391981-75392003 CAGGCAACAGGATGGGAAAGGGG - Intergenic
1160480122 18:79232298-79232320 CAGACAAGGTGTGGGGAAGGAGG - Intronic
1160842266 19:1151379-1151401 CAGGCTAGGGGATGGGACGGGGG + Intronic
1161711067 19:5848330-5848352 CAGGCTAAGGGAGAGGAAGGAGG - Intronic
1161851478 19:6740001-6740023 GAGGCACAGGGTTGCGAATGAGG + Intronic
1162078106 19:8202367-8202389 GAGGGAAAGGGTGGGGAGGGAGG + Intronic
1162833810 19:13303322-13303344 CAGCCAAGAGGGTGGGAAGGGGG - Intronic
1163047921 19:14658597-14658619 CAGGCAGAGGGGTGGGCAGGTGG + Intronic
1163054262 19:14706451-14706473 CAGGCAGGGGCTGGGGAAGGTGG - Intronic
1163085784 19:14979237-14979259 GAGGCCACGGGTTGGGGAGGTGG + Intronic
1163105614 19:15121439-15121461 CAGGCAAAGGGAAGGGACTGAGG + Intronic
1163243140 19:16076463-16076485 CAGGCAAAGGCTTGGGGGGCCGG + Intronic
1163454310 19:17397291-17397313 AAGGCCAGGGGTTGGGAATGGGG - Intergenic
1164003990 19:21132659-21132681 CAGGCTTTGGGTTGGGAAGAAGG + Intergenic
1164145487 19:22510189-22510211 GTGGCAAAGGGTGGGGCAGGAGG + Intronic
1164561225 19:29293578-29293600 CAGGCAAAGGGAGGGTACGGTGG - Intergenic
1164804749 19:31108188-31108210 CAGGCTATGGGTAGGCAAGGTGG + Intergenic
1164899319 19:31904978-31905000 CAGGGAAGGGGTGGGGCAGGAGG + Intergenic
1166101007 19:40571296-40571318 GAGGGTAGGGGTTGGGAAGGGGG + Intronic
1166382810 19:42363483-42363505 GAGGCCAGGGGTTGGGAAAGTGG - Intronic
1166732254 19:45065662-45065684 CAGGCAAGGGGACCGGAAGGGGG - Intronic
1166827959 19:45621158-45621180 CAGGGAAAGAGCTGGGAAGAGGG + Intronic
1166852132 19:45766082-45766104 CAGACACAGGGTTGGCCAGGAGG + Exonic
1167406201 19:49310288-49310310 CAGGAGGAGGGTTGGGATGGCGG + Intronic
1167412958 19:49355840-49355862 AAGGCAAAGGCTTGGGTTGGGGG + Intronic
1167785193 19:51630252-51630274 CAGGCACAGGGGTGAGAAGGGGG - Intronic
1167787292 19:51646676-51646698 CAGGCACAGGGGTGAGAAGGGGG - Intronic
1168069243 19:53940697-53940719 TGGGCAAAGGTTTCGGAAGGAGG - Intronic
1168241238 19:55089934-55089956 AAAGAAAGGGGTTGGGAAGGTGG - Intergenic
1168402513 19:56093566-56093588 CAGGGAAAGGGATGGGAGGAGGG - Intronic
1168418693 19:56186281-56186303 GAGGCAGAGGGGTGGGTAGGTGG + Intergenic
1168701221 19:58440682-58440704 AAGGCACAGGGTGGGGAAGGGGG - Intergenic
925199226 2:1952828-1952850 AAGGCAAAGGTAAGGGAAGGAGG - Intronic
925292389 2:2756384-2756406 CAGGGAAGGGGTTGGGGAGACGG - Intergenic
925310944 2:2881162-2881184 CAGGCAGAGGGCAGGGCAGGAGG - Intergenic
925446599 2:3931527-3931549 CAGGCATTGGGTTGGGGAAGCGG - Intergenic
925706554 2:6689822-6689844 CAGGTAAAAGGGTGGGAGGGGGG + Intergenic
925708421 2:6713414-6713436 CAGGAAAAGGCCTTGGAAGGTGG + Intergenic
926154747 2:10447813-10447835 CCGCCGAAGGGTTGGGAAAGAGG + Intronic
926399907 2:12486850-12486872 CAGGTAAGGCTTTGGGAAGGAGG - Intergenic
926848578 2:17169589-17169611 CAGCTAAAGGGTTGGCAAGGAGG + Intergenic
928687064 2:33760664-33760686 GAGTCAAAGGGTGGGGAGGGTGG + Intergenic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
929662607 2:43803537-43803559 CAGGGGAGGGGTCGGGAAGGAGG + Intronic
930019762 2:46994419-46994441 CAGGCAGAGGGTGGGACAGGGGG - Exonic
930232203 2:48854747-48854769 CAGAAAAAGGAATGGGAAGGGGG - Intergenic
931245989 2:60493410-60493432 CAGGGAATGGGGTGGGAGGGGGG - Intronic
931312133 2:61092087-61092109 CAGGCCAAGAGTTGGGAATTAGG - Intronic
932086977 2:68771298-68771320 CAGGCGGAGGGTTGGAGAGGGGG - Intronic
932330132 2:70894071-70894093 GAGGCAAAGGGAGGGGGAGGTGG + Intergenic
933523371 2:83403878-83403900 GAGGGGAAAGGTTGGGAAGGGGG + Intergenic
933659790 2:84917948-84917970 CTGGCAAAGAGAAGGGAAGGTGG + Intergenic
933718088 2:85376753-85376775 TAGCCAAAGGGTGGGGAAAGAGG - Intronic
934474442 2:94584790-94584812 TAGGCAAACAGCTGGGAAGGTGG - Intergenic
934626916 2:95867080-95867102 CAGGCCATGGTTTTGGAAGGTGG + Intronic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
934806643 2:97234210-97234232 CAGGCCATGGTTTTGGAAGGTGG - Intronic
934830866 2:97522965-97522987 CAGGCCATGGTTTTGGAAGGTGG + Intronic
935034307 2:99353681-99353703 CAGGTGAGGGGTTGGGGAGGTGG - Intronic
935753835 2:106261946-106261968 GAGGCAGAGGGCTGGGATGGAGG - Intergenic
935979157 2:108609528-108609550 AATGCAAAGGCATGGGAAGGTGG - Intronic
936851162 2:116899845-116899867 AAGGGGAAAGGTTGGGAAGGGGG - Intergenic
937315240 2:120927992-120928014 CAGGGACAGGGTTAGGCAGGTGG - Intronic
937651077 2:124319790-124319812 AAGGAAGGGGGTTGGGAAGGTGG + Intronic
937680661 2:124640818-124640840 CAGGTGAAGGGTTAGGAAGGAGG + Intronic
937898154 2:126994376-126994398 CAGGCAAAGGCTTGGGCAAAGGG + Intergenic
938839378 2:135144228-135144250 CAATCAAAGGGTAAGGAAGGTGG + Intronic
938922356 2:136007015-136007037 TAGGAAAGGGATTGGGAAGGAGG - Intergenic
940195978 2:151094535-151094557 CTGCCAGAGGGTTGGGGAGGTGG + Intergenic
940921760 2:159315493-159315515 CAGGCACAGGGCTGGTAAGCTGG + Intergenic
941219921 2:162765057-162765079 CAGGAGAAGGGTAAGGAAGGAGG + Intronic
941371853 2:164675210-164675232 CAGACTGATGGTTGGGAAGGAGG + Intronic
942515532 2:176748521-176748543 GGGGCAAAGGCATGGGAAGGAGG + Intergenic
943046125 2:182864337-182864359 CAGGCCAAGGGCTAGGAATGAGG - Intronic
944454073 2:199875603-199875625 CAGGCATGGGTTTGGGAATGGGG - Intergenic
946260493 2:218486458-218486480 CAGGCAACTGGGTGGGAGGGAGG + Intronic
946340339 2:219062518-219062540 CGGGCAAAGGGGAGGAAAGGAGG - Intergenic
946945753 2:224820355-224820377 CAGGCAAAGTGTGGAGCAGGAGG + Intronic
947184011 2:227438759-227438781 CAGCCAAAGGATCAGGAAGGAGG + Intergenic
947429985 2:230019116-230019138 CAGGCAAAGGCTAGGGAGAGAGG + Intergenic
947435975 2:230072557-230072579 CAGGCAAAGTTTTATGAAGGAGG + Intergenic
947671117 2:231936062-231936084 AAGGGAAAGGGAAGGGAAGGAGG - Intergenic
947749809 2:232526200-232526222 CAGTCAGAGGGATGGGATGGAGG + Exonic
948302382 2:236917442-236917464 CAGGCAGGGGCTTGGGAAGTGGG + Intergenic
948720786 2:239898882-239898904 CATGTAAAGGGGTGTGAAGGAGG + Intronic
948909995 2:240998229-240998251 CATGCTCAGGGCTGGGAAGGGGG + Intergenic
1169544638 20:6637999-6638021 CAGGCAATAGGTAAGGAAGGTGG - Intergenic
1169959263 20:11140677-11140699 CTTGCCAAGGGCTGGGAAGGAGG + Intergenic
1171396665 20:24838874-24838896 CAGGCAGATGGTTGGCAATGGGG - Intergenic
1172179063 20:32989589-32989611 CAGTCAGATGGTGGGGAAGGGGG + Intronic
1172625963 20:36347036-36347058 CAGGCAAAGCTTCAGGAAGGAGG - Intronic
1172776585 20:37411027-37411049 CAGGCAAAGGGTCGGGAGCAGGG - Intergenic
1172787193 20:37476481-37476503 AAGGAAAAGGGTTGGGAATCAGG - Intergenic
1172842720 20:37911711-37911733 CAGGCACAGGGTGGGGGAGAGGG - Intronic
1173058610 20:39640174-39640196 CAGGCACAGTGTTGGGAAGTGGG - Intergenic
1173123550 20:40316093-40316115 CAAGAGAAGGGTTGGGATGGAGG + Intergenic
1173143218 20:40502908-40502930 CAGGCAAAGGGGCGGAAAGAGGG + Intergenic
1173600940 20:44294744-44294766 CAGGCAGGGGCTTGGGAAGTGGG + Intergenic
1173743464 20:45419018-45419040 GAGGCAAAGGTTTGGGCAGGAGG - Intronic
1173821323 20:46022130-46022152 CAGGGAAGGGGTTTGGACGGAGG + Intronic
1174102254 20:48136758-48136780 CTGGAAAGGGGATGGGAAGGTGG - Intergenic
1174421403 20:50401360-50401382 CAGGGACAGGGATGGGAAGGAGG - Intergenic
1174527587 20:51186009-51186031 CAGGTAAGGGGTTGGGGAAGGGG + Intergenic
1174890024 20:54381859-54381881 AAGGGAAAGAGGTGGGAAGGAGG - Intergenic
1175536966 20:59721562-59721584 CAGGCCAGGAGTTGGGAAGGGGG + Intronic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1175899982 20:62356165-62356187 CAGACAGATGGTTGGGATGGGGG - Intronic
1176094893 20:63336094-63336116 CAGCCACGGGGTGGGGAAGGTGG + Intergenic
1176999727 21:15597334-15597356 CAGGGGAAAGGATGGGAAGGGGG - Intergenic
1177048717 21:16204150-16204172 GTGGCAAAGGGCTGAGAAGGAGG + Intergenic
1178738855 21:35177814-35177836 CAGGAAAAGGGTGGGCAATGTGG - Intronic
1179171465 21:38976199-38976221 CAGGCATGGGTTTGGGAAGCAGG + Intergenic
1179383980 21:40924741-40924763 CAGGCACAGGGTTGGGGGCGGGG + Intergenic
1179893400 21:44349171-44349193 CCTGCAAAGTGGTGGGAAGGCGG - Intergenic
1180049310 21:45324124-45324146 GAGGCTGAGGGTTGGGAGGGAGG - Intergenic
1180835716 22:18928557-18928579 GAGGCAGAGGGTTGGGGAGCTGG - Intronic
1180953638 22:19731648-19731670 CTGCCAACGGGTGGGGAAGGGGG + Intergenic
1181102602 22:20551355-20551377 CAGGCGAGGGGGCGGGAAGGGGG + Intronic
1181387952 22:22558485-22558507 AAAACAAAGGGTTGGGGAGGGGG + Intronic
1181998793 22:26903612-26903634 GAGGGAAAGGGCTGGGGAGGGGG + Intergenic
1182422665 22:30256153-30256175 CAGGCCAAGGCTGGAGAAGGGGG + Intergenic
1182437575 22:30340662-30340684 CAGCCCGAGGGTTGGGAAGCAGG + Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1183333271 22:37232567-37232589 GAGGCAATGGGGTGGGAAGATGG + Intronic
1183440091 22:37818172-37818194 CAGGCAAATGGGTGGGCTGGAGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1184035702 22:41917144-41917166 CCGGCAACGGGTGGGAAAGGTGG - Intergenic
1184288524 22:43485982-43486004 CAGGCAAAGGCTGGGGGAGATGG - Intronic
1184427522 22:44421714-44421736 GAGGGGAAGGGATGGGAAGGGGG - Intergenic
1184697462 22:46148010-46148032 CAGGGAAAGAATTGGGAAGCTGG - Intergenic
1184881194 22:47305067-47305089 CAGGCCGAGGGTTAGGAAGGTGG - Intergenic
1203285805 22_KI270734v1_random:153856-153878 GAGGCAGAGGGTTGGGGAGCTGG - Intergenic
949148750 3:738363-738385 CAGGCATTGGGTGGGGATGGAGG - Intergenic
949500633 3:4677057-4677079 TAGGCAGAGGGTTGGCATGGAGG - Intronic
949773861 3:7609558-7609580 CAGGCACAGGTATGGGTAGGTGG + Intronic
950170535 3:10835827-10835849 CAGAAACAGGGTTGGGAGGGGGG + Intronic
950226123 3:11235849-11235871 CAGCCAAAGGACTGGGAAAGAGG - Intronic
950264667 3:11564887-11564909 CAGGCCAAGGCTGGGGAGGGAGG + Exonic
950381925 3:12623507-12623529 CAGGCTAAGGGTTGGGTGCGGGG + Intronic
950452127 3:13071480-13071502 CAGGCAAAGGTGTGGCAGGGAGG + Intronic
951563395 3:23989508-23989530 GAGGCACAGGGTTGGGGAGAGGG - Intergenic
951889426 3:27554668-27554690 AAACAAAAGGGTTGGGAAGGAGG + Intergenic
952312999 3:32207366-32207388 CATGCAAAGGGTTTGCAAGGAGG + Intergenic
952653481 3:35755314-35755336 CAGACTTAGGTTTGGGAAGGTGG - Intronic
952896197 3:38080691-38080713 CAGGCTAAGGGAGGAGAAGGAGG + Intronic
953676061 3:45003296-45003318 TAGCCAAAGGGTTGGGAAATTGG + Intronic
953742691 3:45551171-45551193 CAGGCAAAGTGTAGTGCAGGAGG + Intergenic
953939576 3:47080939-47080961 CAGGAAGATGGTTGGGAAGTTGG - Intronic
954112814 3:48444874-48444896 CAGGCAAGGGGTTGGGGGTGAGG + Intergenic
954574059 3:51665175-51665197 CTGGCAAAGTGTTGGGGTGGGGG - Exonic
954603912 3:51894247-51894269 CAGGCAAGGGGGTGGGAGAGAGG - Intergenic
954863097 3:53706347-53706369 GAGGCAAAGGCTTGGGCTGGAGG + Intronic
955999989 3:64719511-64719533 TGGGCAAAGGCTTGGGAAGGTGG - Intergenic
956036454 3:65097743-65097765 CAGGCAACTGGTGGTGAAGGTGG + Intergenic
956216910 3:66858520-66858542 AAGGGAATGGGATGGGAAGGTGG - Intergenic
956269560 3:67436294-67436316 CTGGCAAAGGGCTGGAAAGCAGG - Intronic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
959766657 3:110039075-110039097 CAGGGAGAAGTTTGGGAAGGGGG - Intergenic
959820498 3:110729797-110729819 CAGGAAGAGAGTTGGGAAGTGGG - Intergenic
959902830 3:111679255-111679277 GAGGGTCAGGGTTGGGAAGGAGG + Intronic
960702615 3:120451776-120451798 AAGGCCAAGGGCTGGGAAGAAGG - Intergenic
961360683 3:126365283-126365305 GAGGCAGAGGTTTGGGAAGAAGG + Intergenic
961464206 3:127071647-127071669 CAGGGACAGGGTGGGGCAGGTGG + Intergenic
961812886 3:129531937-129531959 CACGCAGAGGGTTGGTGAGGAGG - Intronic
962494589 3:135926507-135926529 CTGGCAAAGGGTTAGGAAAATGG + Intergenic
963273642 3:143309222-143309244 CAGTCTGAGGCTTGGGAAGGTGG + Intronic
963318149 3:143783340-143783362 CAGGCAGAGGGAAGGCAAGGGGG - Intronic
964332203 3:155615761-155615783 CAGGGGGAGGGTTGGGATGGGGG + Intronic
964486136 3:157186765-157186787 CAGGCAAAGTGACGCGAAGGAGG - Intergenic
964698128 3:159533238-159533260 AAGGCAAGGGGTTGGGGAAGGGG + Intronic
964983498 3:162713652-162713674 CAGGCTAAGGGAGGAGAAGGAGG - Intergenic
965912323 3:173794103-173794125 CAGGCAAAGGGCTGGGTATGAGG - Intronic
966283957 3:178270884-178270906 CTGGCTCAGGGTTGGGAAGGAGG + Intergenic
966751113 3:183323083-183323105 CAGCCACAGGGTGGGGAAGAAGG - Intronic
966826271 3:183967514-183967536 CAGGCAGAAGGCTGTGAAGGGGG + Intronic
967316457 3:188155089-188155111 GAGGCAAGGGGTTGGGGATGGGG + Intronic
967858570 3:194135302-194135324 AAGGGAAAGGGTGGTGAAGGAGG + Intergenic
967986753 3:195100878-195100900 CAGGCACAGGGTTAGGCAGCAGG - Intronic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968666171 4:1823452-1823474 CAGGCAAGGGGCTGGTGAGGAGG + Intronic
968810130 4:2796015-2796037 CAGGCCAAGGGGTGGTGAGGAGG - Intronic
968922888 4:3531863-3531885 CAGGCAAAGGCTCGGGAGGCAGG + Intronic
969056580 4:4406411-4406433 AATGCAAAGGGTTACGAAGGAGG + Intronic
970640223 4:18055966-18055988 CAGGCAAAGGTTTGAGAGGTAGG + Intergenic
971158610 4:24109756-24109778 TAAGCAAAGGGCTAGGAAGGAGG + Intergenic
971670899 4:29555947-29555969 CAGAGAGTGGGTTGGGAAGGGGG + Intergenic
972228696 4:37044979-37045001 CAGGTAGAGGCTTGGGAAGTGGG + Intergenic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
973735362 4:53866044-53866066 CAGGGCACGGGTGGGGAAGGAGG + Intronic
973907468 4:55546402-55546424 GCGGCCAAGGGTGGGGAAGGCGG - Intronic
973973189 4:56235840-56235862 CAAGACAAGGGTTGGGAAGGAGG + Intronic
974815702 4:67000802-67000824 AGGGGAAAAGGTTGGGAAGGGGG - Intergenic
974843105 4:67320845-67320867 GAGGCAAAGGGCTGGGACAGTGG + Intergenic
975707202 4:77122916-77122938 CAGGCAGGGGCTTGGGAAGTGGG - Intergenic
975983548 4:80184073-80184095 CAGGCGAAGGGCGGGGAAGGAGG + Intronic
976022808 4:80650856-80650878 CAGGGGAAAGGATGGGAAGGGGG + Intronic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
977163157 4:93661966-93661988 CAGGGAAAGAGCTGGCAAGGCGG - Intronic
977566872 4:98589457-98589479 CAGACAAAGGAAAGGGAAGGAGG + Intronic
977827811 4:101554286-101554308 CAGACAAAGGGGTGGGGAGGGGG - Intronic
978228507 4:106367918-106367940 CAGGCAGTGGGTCGGGAAGTGGG - Intergenic
979850448 4:125566071-125566093 CAGGCAAAGGGGGTAGAAGGAGG + Intergenic
980219854 4:129901019-129901041 CAGGAGAAGGGATGGGAATGGGG - Intergenic
981274621 4:142884059-142884081 GAGGCATAGGGATGGGAGGGTGG + Intergenic
982000203 4:151015274-151015296 CAGGAAAAGGCGGGGGAAGGGGG + Intronic
983792200 4:171812951-171812973 CAGGTAGGGGGTGGGGAAGGAGG - Intronic
985552466 5:540618-540640 AGGGCGAAGGGCTGGGAAGGAGG - Intergenic
985572148 5:652787-652809 CAGGACAGTGGTTGGGAAGGAGG + Intronic
985646622 5:1088039-1088061 CAGGCAGCGGGCTGGGGAGGGGG - Intronic
986081068 5:4394811-4394833 CATGCAAGCGGCTGGGAAGGAGG - Intergenic
986377814 5:7150433-7150455 CAGGCAATGGGATGGGACTGGGG - Intergenic
987253375 5:16123083-16123105 GAAGCAAAGGGTTCGGAAGAGGG - Intronic
988200573 5:28063729-28063751 AAGGAAATGGGTTGGGAAGGGGG - Intergenic
988773264 5:34452573-34452595 TAGTCACAGGCTTGGGAAGGCGG - Intergenic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
989997191 5:50849790-50849812 AGGGCAAAGGGTCAGGAAGGAGG - Intergenic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990873091 5:60454981-60455003 CAGGGAAAGGGTGGGGAACAGGG + Intronic
992364051 5:76073743-76073765 CAGGCAAAAGGGTGGAAGGGCGG + Intergenic
994109101 5:95980736-95980758 CAGGGAATGGGTTGGGCAAGTGG - Intergenic
994685606 5:102947522-102947544 CAGGGTAAAGGATGGGAAGGAGG + Intronic
995043829 5:107621267-107621289 CAGGCCCAGGGTTGGGAAGCCGG + Intronic
997074698 5:130659065-130659087 CTGGCAGTGGGTTGGGGAGGAGG + Intergenic
997462224 5:134060642-134060664 AAGACAAAGGATGGGGAAGGAGG + Intergenic
997957540 5:138291378-138291400 AAGAAAAAGGGTTGGGAAGACGG + Intronic
998147783 5:139740098-139740120 TAGGCACAGGGGTGGTAAGGTGG + Intergenic
999061889 5:148644681-148644703 CAGACAAGGGGATAGGAAGGTGG + Intronic
999238488 5:150114112-150114134 CACGGGGAGGGTTGGGAAGGGGG - Exonic
999698595 5:154207669-154207691 CAGGGAAATGGCTGGGCAGGGGG + Intronic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1001026150 5:168225985-168226007 CAGAGAAAGAGCTGGGAAGGTGG - Intronic
1001589286 5:172854541-172854563 CAGGCACAGGTTTGGGATGTGGG - Intronic
1001745805 5:174091364-174091386 CAGGCCAAGAGCTGGGCAGGCGG + Intronic
1003413262 6:5884799-5884821 CAGACCTAGGGTTAGGAAGGTGG + Intergenic
1003848158 6:10195418-10195440 CAGGCATGGGCTTGGGATGGGGG + Intronic
1004076227 6:12346527-12346549 CAGGCACAGATTTGGGAAGTGGG - Intergenic
1004681833 6:17903632-17903654 CAGGCACAGGGATGGGGATGTGG + Intronic
1004836861 6:19540167-19540189 CAGGCTAAGGGATAAGAAGGAGG - Intergenic
1005989890 6:30896229-30896251 CGGGACAAGGGTTTGGAAGGTGG + Intronic
1006123507 6:31822125-31822147 CAGCCAAAGGGGAGGAAAGGTGG - Intergenic
1006179501 6:32146103-32146125 TAGGCAGAGATTTGGGAAGGAGG + Intergenic
1006288522 6:33116524-33116546 CAGGCAGGGAGTTGGGTAGGGGG + Intergenic
1006655851 6:35592308-35592330 CAGGCAAAGGGTAAAGAAAGTGG - Intronic
1007173256 6:39879262-39879284 CAGGCAAAGGGCAGAGGAGGAGG - Exonic
1007189879 6:40004386-40004408 CAGGTAAAAGGTTGGGATGATGG - Intergenic
1007227878 6:40327680-40327702 CTTGCAAAGGGTTGGGAGGTTGG - Intergenic
1007474018 6:42107244-42107266 AAGGCCAAGGGTGGGGCAGGGGG + Exonic
1007511536 6:42378035-42378057 GAGGCAAGGGATTGGGAAGGGGG + Intronic
1007724041 6:43903722-43903744 CAGGAAAAGAGTTGGGAGAGGGG - Intergenic
1008557354 6:52686659-52686681 AACGAAAAGGGTTGAGAAGGAGG + Intergenic
1008754865 6:54782527-54782549 GAGGCTAAGTGTTGGGAGGGTGG + Intergenic
1009595424 6:65729276-65729298 CAGACGAAGGGGTGGGAAGGAGG - Intergenic
1009995217 6:70889122-70889144 GAAGCCAAGGGCTGGGAAGGTGG - Intronic
1010358637 6:74965927-74965949 CAGCCAAAGGTGTGGGCAGGTGG - Intergenic
1011135714 6:84098109-84098131 CAGAGAAAGGGATGGGAGGGAGG - Intergenic
1011170179 6:84496876-84496898 CAGGGAAAGGGTTAGAAAGATGG + Intergenic
1011651814 6:89513362-89513384 CAGGTTAAGGATTGGGAGGGGGG - Intronic
1011704832 6:89990448-89990470 GAGACACAGGGTTGGGTAGGTGG - Intronic
1012374748 6:98547910-98547932 CAGGCAGAGTGTGGGGAAGCTGG - Intergenic
1012816767 6:104032487-104032509 CAAGAAAAGGTTTGTGAAGGCGG + Intergenic
1012863624 6:104592086-104592108 CAGGAATGGGGGTGGGAAGGGGG + Intergenic
1013206981 6:107954036-107954058 CAGGGAAAGGATTGGGAAATCGG + Intronic
1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG + Intronic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015120171 6:129692428-129692450 CAGGCAAATGGTTTGTATGGAGG - Intronic
1015638387 6:135303818-135303840 GGGGCATAGGGTTGGGAAGCAGG - Intronic
1016741407 6:147533067-147533089 CAGGCCTTGGGTTGGGAAGGGGG + Intronic
1016871896 6:148825937-148825959 CAGGAATAGGGTTGAGGAGGGGG + Intronic
1017122236 6:151035161-151035183 TAGGCAAACAGCTGGGAAGGTGG + Intronic
1017643474 6:156516728-156516750 CAGGGGCAGGGTGGGGAAGGAGG - Intergenic
1017682570 6:156878758-156878780 CAGCCAAATGGTTGGACAGGTGG + Intronic
1017778583 6:157698816-157698838 CAGGCAAAGGCTTGGGAAGTGGG + Intergenic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018655778 6:166034248-166034270 CAGGCAAGGGACTGGGACGGAGG + Intergenic
1019556583 7:1634467-1634489 CAGCGACAGAGTTGGGAAGGAGG - Intergenic
1019709033 7:2510006-2510028 CAGGCCAAGGGGTGGGCAGCTGG - Intergenic
1019809303 7:3152821-3152843 CAGGCAAAGTGCTGGGAACATGG - Intronic
1020210726 7:6156244-6156266 CAGGCACATGGGAGGGAAGGAGG + Intronic
1020782243 7:12532081-12532103 CTGGCAAAGGGAAGGGAAGATGG + Intergenic
1020884114 7:13801483-13801505 TAGACAAAGGTTTGGGATGGAGG - Intergenic
1021310582 7:19091007-19091029 CAGGCACAGAATTGGAAAGGAGG + Intronic
1021952727 7:25790908-25790930 CAGGCATAGTGTTGGGAACTTGG + Intergenic
1022028358 7:26469123-26469145 CAGTCAAAGGATTGGGAAGGGGG - Intergenic
1022342340 7:29480249-29480271 CAGGCAAAGAGTTTGAGAGGGGG - Intronic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1023256655 7:38319033-38319055 CAGGCCAAGACTTGGGTAGGAGG - Intergenic
1023522813 7:41065841-41065863 CAGGCTGTGGGTGGGGAAGGCGG + Intergenic
1024055831 7:45659360-45659382 CAGGGAATGGTTTTGGAAGGTGG + Intronic
1024962470 7:54991793-54991815 AAGGCAAGGGGCAGGGAAGGGGG + Intergenic
1025249423 7:57342104-57342126 CAGGGACAGGGATGGGAAGGAGG + Intergenic
1026413492 7:70153418-70153440 CAGGCACAGAATTGGGAGGGAGG + Intronic
1026461506 7:70619131-70619153 CCGGCAAGGGGATGGGGAGGGGG - Intronic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1027299101 7:76810718-76810740 CAGGCACAGGGTAGGTAAGATGG - Intergenic
1027954931 7:84865640-84865662 CAGGAAAAGGGTTGGGGACCGGG + Intergenic
1028651385 7:93153704-93153726 CAGTCAAACTGTTGGGTAGGTGG + Intergenic
1028679167 7:93505835-93505857 CTGGCAAAGAGAAGGGAAGGTGG - Intronic
1029628292 7:101734119-101734141 CAGGCAGATGGGTGAGAAGGGGG - Intergenic
1030018155 7:105244972-105244994 CAGGGAGAGGGCAGGGAAGGGGG - Intronic
1030095433 7:105894571-105894593 CAGGCAATGGACTGGGAAGATGG + Intronic
1030100553 7:105941594-105941616 TAGGGAAAGGCCTGGGAAGGGGG - Intronic
1030638258 7:111974575-111974597 AAGGAAAAGGGATGGGGAGGAGG + Intronic
1030971409 7:116062018-116062040 TAGGGGAAGGGATGGGAAGGAGG - Intronic
1031937199 7:127747960-127747982 GAGTAAAAGGGGTGGGAAGGGGG - Intronic
1032018547 7:128394224-128394246 GAGGCAGTGGGTTGGGCAGGTGG - Intronic
1032189322 7:129754544-129754566 CTGGGGAAGGGTTGGGGAGGGGG + Intronic
1032328263 7:130952170-130952192 CAAACACAGGCTTGGGAAGGTGG + Intergenic
1032425565 7:131819891-131819913 AAGGCATAGGGTTGGGAGAGGGG - Intergenic
1032484663 7:132276443-132276465 AAGGGAAAGGGTGGGAAAGGGGG - Intronic
1032568202 7:132970183-132970205 CAGGCAAAAGCTTGGAAACGTGG - Intronic
1032853719 7:135816690-135816712 CAGGCAGAGGGATGGGACTGTGG + Intergenic
1032879278 7:136071895-136071917 CAGGAAAGGGATTGGCAAGGTGG - Intergenic
1033415765 7:141160201-141160223 CAGGGAAAGGGGTGGGAGTGGGG - Intronic
1033426140 7:141245944-141245966 CTGGAAAAGGGTTTGGAAGTAGG + Intronic
1034275326 7:149821468-149821490 CAGGCACAGGGGTGGGCACGAGG - Intergenic
1034537234 7:151733056-151733078 CAGGCACAGGCTTGGGAGGGAGG + Intronic
1035138670 7:156734491-156734513 AAGGGAGAGGGTTGGGATGGAGG + Intronic
1036135638 8:6158725-6158747 GAGGCACAGGGATGGGAAGGTGG - Intergenic
1036405156 8:8448159-8448181 AAGGCAGAGGGTAGGGAGGGAGG + Intergenic
1036668519 8:10764262-10764284 CAGACACAGGGCTGGGAAGGTGG + Intronic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037803645 8:22048280-22048302 AAGGGAAAGGGGTGGGGAGGCGG - Exonic
1039258595 8:35746082-35746104 CAGGGAAAGACTGGGGAAGGGGG - Intronic
1039403455 8:37292976-37292998 CCAGCAAAGGGTTGTGAAGATGG + Intergenic
1040820344 8:51548965-51548987 AAGGCAAAGGGATGGGAAAAGGG + Intronic
1042002444 8:64140137-64140159 AAGGCAAAGTGTGGGGAAGACGG + Intergenic
1042139039 8:65661048-65661070 GATGCCAGGGGTTGGGAAGGAGG + Intronic
1042225038 8:66508556-66508578 CAGGGAAAGTGCTGGGAAGCAGG - Intronic
1042313707 8:67402937-67402959 CGGGGAAAGGGCTGGGAATGGGG - Intergenic
1043538258 8:81230011-81230033 CATGCAAAGTGTTGGGCAGGTGG + Intergenic
1043691614 8:83160463-83160485 CAGGGAAAAGGGTGGGAGGGGGG - Intergenic
1043979473 8:86621632-86621654 CAGGGAGAAGGGTGGGAAGGGGG - Intronic
1044387019 8:91601187-91601209 CAGGCAAAGGGTTAGATAGAGGG + Intergenic
1044666907 8:94641100-94641122 CAGGAAGGGGGGTGGGAAGGAGG - Intronic
1045427110 8:102078084-102078106 CAGGGAAAGGGTCAGGATGGGGG - Intronic
1047480223 8:125275162-125275184 CAGGAAAAGGATATGGAAGGGGG - Intronic
1047962166 8:130018284-130018306 CAGGAAAAGGGTTTGGAAGCAGG + Intergenic
1048168582 8:132084673-132084695 CAGGCTAAGGGATAAGAAGGAGG + Intronic
1049061059 8:140276627-140276649 CAAACAGTGGGTTGGGAAGGAGG + Intronic
1049291844 8:141807488-141807510 CAGGCAAAGTGCCGGGAAGCTGG + Intergenic
1049414001 8:142487229-142487251 CAGGCGAAGGGGTGGGAGGCTGG - Intronic
1049601214 8:143508662-143508684 CAGGGAAGCTGTTGGGAAGGCGG - Intronic
1049964371 9:765214-765236 AAGTCAAAGGGTTGAGAGGGTGG - Intergenic
1050151513 9:2622626-2622648 CAGGCGCAGTGTTGGGAAGGAGG + Intronic
1050621490 9:7456648-7456670 CAGTCAAAGGGGTGGGGTGGGGG + Intergenic
1051064955 9:13092211-13092233 CAGACAAAGGCTTGGCAAGCAGG + Intergenic
1051065176 9:13093900-13093922 CAGGCAATGGCGTGGGAAAGGGG + Intergenic
1051105744 9:13577950-13577972 CAGGCAATGGGTGAGGAAGTGGG + Intergenic
1051752482 9:20357823-20357845 CAGGCAAGGAGTATGGAAGGAGG + Intronic
1053424981 9:38004597-38004619 GGGGCAGAGGGTGGGGAAGGGGG + Intronic
1053683626 9:40501312-40501334 TAGGCAAACAGCTGGGAAGGTGG + Intergenic
1053933607 9:43129629-43129651 TAGGCAAACAGCTGGGAAGGTGG + Intergenic
1054280088 9:63123609-63123631 TAGGCAAACAGCTGGGAAGGTGG - Intergenic
1054296729 9:63336809-63336831 TAGGCAAACAGCTGGGAAGGTGG + Intergenic
1054394746 9:64641315-64641337 TAGGCAAACAGCTGGGAAGGTGG + Intergenic
1054429394 9:65146515-65146537 TAGGCAAACAGCTGGGAAGGTGG + Intergenic
1056456853 9:86768518-86768540 CTGGGAAAGTGTTGGGAAGCTGG - Intergenic
1057117450 9:92539353-92539375 CAGGCAGTGGGTTGGGGTGGGGG - Intronic
1057567551 9:96178675-96178697 CAGGGCATGGGATGGGAAGGAGG + Intergenic
1058133939 9:101286525-101286547 CAGGCAAGGGGTTGGGGTGGGGG + Intronic
1058144972 9:101400430-101400452 GAGACAAAGGATGGGGAAGGAGG - Intronic
1059133216 9:111777004-111777026 CAGGTAAGGGCTTGGGAAGTGGG + Intronic
1059659064 9:116383223-116383245 CCAGCCAAGGGTTGGGAGGGAGG + Intronic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1060437510 9:123606943-123606965 CATGCAGAGGGTTGGGAATGTGG + Intronic
1060869851 9:127030766-127030788 AAGGCAGAGGGGTGGGATGGGGG + Intronic
1060937083 9:127522062-127522084 CAGGCCAGGGGCTGGGGAGGCGG + Intronic
1061180465 9:129022437-129022459 AAGGCCAAGGGGTGGGGAGGGGG + Intronic
1061389595 9:130310099-130310121 CAGGCAGAGGGCTGGGAAAGGGG - Intronic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061670405 9:132185225-132185247 GAGGCCCAGGGTGGGGAAGGGGG - Intronic
1061962329 9:133994379-133994401 CAGGCGAGGGGTTGGGAGAGTGG - Intergenic
1062581268 9:137230230-137230252 CAGGCAGCGGGTGGGGAAGGTGG + Intergenic
1186383832 X:9089367-9089389 CTTGCAAAGGGGTGGGTAGGGGG - Intronic
1186465168 X:9779228-9779250 CAGGCAGGGGGTGGTGAAGGCGG + Intronic
1187412549 X:19063639-19063661 CAGACAAAAGGTTGGCGAGGCGG - Intronic
1189054035 X:37679786-37679808 CAGGCAAAGGGGTGGGTGAGGGG + Intronic
1189116065 X:38343879-38343901 CAGGAAAAGGGATGGAGAGGGGG + Intronic
1189288444 X:39868308-39868330 CAGGCAAAGCCCTGGGAAGCTGG - Intergenic
1189397456 X:40635716-40635738 CTGGAAAAGGGTGGAGAAGGTGG - Intronic
1189782747 X:44531696-44531718 CAGGAAAAAGGTTGGGGAGGGGG + Intronic
1190024830 X:46913101-46913123 CAGGCAAAGGGCAGGAACGGAGG - Intronic
1190049974 X:47142266-47142288 CAGGCAGGGGGTGGGGAAGGCGG + Exonic
1190301372 X:49059377-49059399 CAGGGATAGGGTGGAGAAGGGGG - Intronic
1191803821 X:65111828-65111850 CAGGAAATGGGAGGGGAAGGGGG - Intergenic
1192238928 X:69314478-69314500 CAGGCAAGGGGGAGGGAGGGTGG - Intergenic
1192318025 X:70067026-70067048 CAGGCGAAGGCTGTGGAAGGAGG + Intergenic
1192345745 X:70303861-70303883 CAGGGAAAGGGGTGGGAATGGGG - Intronic
1194678458 X:96821445-96821467 CAGCCAAGGGGTTGGGAAGCAGG + Intronic
1194975582 X:100393298-100393320 ATGTCAAAGAGTTGGGAAGGGGG + Intronic
1195482367 X:105360547-105360569 GTGGCATAGGGTGGGGAAGGGGG + Intronic
1195657586 X:107347015-107347037 CAGGGAAAGATTTGGGAGGGAGG + Intergenic
1195674792 X:107499860-107499882 CAGGCCCAGAGTTGGGAGGGAGG - Intergenic
1196179189 X:112671601-112671623 CAGGCAGAAGGAAGGGAAGGTGG - Intronic
1196829304 X:119763672-119763694 AAGGCAGAGGGTTTGGCAGGAGG + Intergenic
1196937172 X:120741502-120741524 CAGGCAAGGTGGTGGGCAGGTGG - Intergenic
1197167645 X:123395426-123395448 CAGGCAAAGGGTGGGGGCAGTGG + Intronic
1199424802 X:147688830-147688852 AAGGGAAAGGGTTTGGAAGAGGG - Intergenic
1199594551 X:149496196-149496218 CAGGCAAAGTGCTGGGGTGGAGG - Intronic
1200051318 X:153433358-153433380 CAGCCACAGGGTTGGGCAGCTGG + Intergenic
1200100093 X:153685924-153685946 CTGGCAAAGGGCGGGGAAGAAGG + Intronic
1201731640 Y:17210854-17210876 CAGGCAAAGGAGCTGGAAGGGGG - Intergenic