ID: 1013492023

View in Genome Browser
Species Human (GRCh38)
Location 6:110657145-110657167
Sequence TTGACCAAGTTCACTCTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013492021_1013492023 2 Left 1013492021 6:110657120-110657142 CCTAGAGAAGAGAAAGACCTACA 0: 1
1: 0
2: 1
3: 18
4: 320
Right 1013492023 6:110657145-110657167 TTGACCAAGTTCACTCTGTGCGG 0: 1
1: 0
2: 0
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013492023 Original CRISPR TTGACCAAGTTCACTCTGTG CGG Intronic
904295050 1:29514709-29514731 TAGATCACGTTCTCTCTGTGAGG + Intergenic
904520374 1:31090564-31090586 TTTCCCAAGTTCACACTGTCTGG - Intergenic
905500506 1:38432735-38432757 TTAACAAAGATCTCTCTGTGTGG - Intergenic
907927999 1:58972798-58972820 TTGCCCAAGTTCACACAGTTGGG + Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
912759650 1:112355842-112355864 CTGTCCAAATTCACTCTGTTGGG + Intergenic
913360972 1:117979567-117979589 TTTAAAAAGATCACTCTGTGAGG - Intronic
914489229 1:148140047-148140069 TTGACCAACTTCACACTATTTGG - Intronic
915476816 1:156157791-156157813 TTGACCAAGATCTCTCAGTCAGG + Intronic
916239677 1:162626399-162626421 TTCTCCAAGTTCACTCTGCTTGG + Intergenic
916495490 1:165342925-165342947 TTGCCCAAGGTCACGCTGTTGGG - Intronic
918259401 1:182782086-182782108 CAGACCAAGTTGACTCTTTGTGG - Intergenic
920297884 1:204970457-204970479 TGGACCAAGTTATCCCTGTGAGG + Intronic
921469533 1:215532146-215532168 TTGAGCCAGTTCCCTCTCTGTGG - Intergenic
923682007 1:236125996-236126018 TTTACCATGTTCACTTTGTGGGG - Intergenic
1068939713 10:62668910-62668932 TTGCCCAAGATCACTCAGTTAGG + Intronic
1069110078 10:64436291-64436313 TCTACAAAGTTCACTCTATGTGG + Intergenic
1069134774 10:64750782-64750804 TTGAACGGGTTGACTCTGTGAGG + Intergenic
1070175746 10:73967719-73967741 TTGCCCAAGTTCACCCTGCAAGG + Intergenic
1070427991 10:76308015-76308037 TTGACCAAAATGACTCTATGGGG - Intronic
1071792602 10:88971283-88971305 TTTATCAAGTTAACTCTTTGAGG - Intronic
1073516043 10:104076507-104076529 TTAACCAAGTACACTCAGGGAGG + Intronic
1079599623 11:22295149-22295171 TTCACCAACCTCACTCTGTTTGG - Intergenic
1081989371 11:47329539-47329561 TGGAGCAGTTTCACTCTGTGAGG + Exonic
1086197444 11:84157828-84157850 TTCATGAAGTTCACTCTGTGTGG + Intronic
1086972745 11:93101317-93101339 TTAAACAAGGTCCCTCTGTGAGG + Intergenic
1089535017 11:119155616-119155638 TTTAGAAAGTTCACTCTGTCCGG - Intronic
1091145679 11:133277912-133277934 TTGCCCAAGGTCACTCTGCTAGG + Intronic
1091273568 11:134334218-134334240 GCCACCAAGTTCACTCTTTGTGG + Intronic
1091839013 12:3605792-3605814 TTCAGAAAGTTCACCCTGTGAGG + Intergenic
1093800243 12:23363871-23363893 TAGACCAAGTTAACTTTGGGGGG + Intergenic
1095253623 12:40007667-40007689 TTGCCCAAGTTTACCCTGTTAGG - Intronic
1095880363 12:47129524-47129546 TTGACCTATTACTCTCTGTGGGG - Intronic
1097614640 12:61869452-61869474 TTTCCTAAATTCACTCTGTGAGG + Intronic
1101397163 12:104358497-104358519 TTGCCCAGGCTCACACTGTGTGG + Intergenic
1102523578 12:113494700-113494722 TTCACCAAGGTAACTGTGTGAGG - Intergenic
1103367839 12:120395953-120395975 TTGACCAAGCTCACTGTGAATGG - Intergenic
1106774354 13:32994105-32994127 TTGGCCAAGTTTTCTCTGAGGGG + Intergenic
1106802984 13:33275532-33275554 TCGTCCAAGGTCACTCTATGGGG + Intronic
1107197567 13:37671423-37671445 TTCACCATGTTCAATCTGTATGG - Intronic
1107378478 13:39830487-39830509 TTGAGCATCTTCAATCTGTGTGG - Intergenic
1113469050 13:110531478-110531500 TTGCCCAAGGTCACACGGTGGGG - Intronic
1116597719 14:46872802-46872824 TAGACCTAGTAAACTCTGTGGGG - Intronic
1118454696 14:65933839-65933861 TTGGCCAAGTTCACTCTGCTTGG + Intergenic
1118855817 14:69621382-69621404 TTCACCAAGTTCACCCTGTCTGG + Intronic
1121605429 14:95236733-95236755 TTGTCCAAGGTCACTCAGAGGGG - Intronic
1124347985 15:28935093-28935115 TCGTTCCAGTTCACTCTGTGGGG - Intronic
1124626430 15:31310088-31310110 GGGACCAAATTCAATCTGTGGGG + Intergenic
1128398802 15:67255680-67255702 TTGTCTAAGGTCACTCTGTCAGG + Intronic
1129199504 15:73990504-73990526 TTGCCCAAGTTCACTCCGCTTGG - Intronic
1136016364 16:27403532-27403554 TTGCCCAAGTTCACCGAGTGAGG - Intronic
1137689179 16:50408774-50408796 TTGACCATATTCACTTTGGGTGG + Intergenic
1138166923 16:54811207-54811229 TTGGCCAAGGTCACACAGTGAGG - Intergenic
1138331280 16:56217745-56217767 GTGTCCAAGTTCACTCTCTTAGG + Intronic
1140531193 16:75667945-75667967 CTGACAAAGTTTACTATGTGTGG - Intronic
1140536797 16:75717096-75717118 CTGACAAAGTTTACTATGTGTGG - Intronic
1141903908 16:87010160-87010182 TACACCAGGTTCACTCTCTGTGG - Intergenic
1142284038 16:89164423-89164445 TGGTCCAAGTCCACTCTGTCTGG + Intergenic
1146670190 17:34732082-34732104 TTGACCCAGAACACTCTTTGTGG + Intergenic
1148645638 17:49218349-49218371 TTCACCAAGTCCCCTTTGTGTGG - Intronic
1148706123 17:49634294-49634316 TTTCCCAAGTTCACTCTTTGTGG - Intronic
1150981464 17:70147040-70147062 TTGAGCAAGTACACTCTATGAGG + Intergenic
1151049587 17:70962241-70962263 TTGATCAGGTTTACTCTTTGGGG - Intergenic
1160538777 18:79609448-79609470 TGGCCCAGCTTCACTCTGTGGGG - Intergenic
1163188836 19:15660543-15660565 TTGCTCAAGGTCACTCTGAGTGG + Exonic
1163680001 19:18675854-18675876 GTGACCAACTTCCCTCTGTGGGG + Intergenic
1164933083 19:32190290-32190312 TGGTCACAGTTCACTCTGTGGGG - Intergenic
1165466746 19:35979149-35979171 TTGCCCAAGGTCAGTCTGTCCGG + Intergenic
926881210 2:17545556-17545578 TTTAACATGTTCACCCTGTGAGG + Intronic
929221605 2:39470040-39470062 TTGCCCAAGGTCAGTCTGGGTGG + Intergenic
929489219 2:42381676-42381698 TTCATCAAGTTCATTCTGTTAGG + Intronic
930620159 2:53635293-53635315 TTGACCAAGGAAGCTCTGTGTGG - Intronic
935624856 2:105163730-105163752 TAGACCAAGGTTACCCTGTGGGG - Intergenic
937953161 2:127403753-127403775 TTGACCAAGTTAAATCTGACTGG + Intergenic
938943612 2:136190900-136190922 TTGTCCCAGATCACTCAGTGAGG - Intergenic
939548646 2:143585874-143585896 TTTACCAAGTTTTCTCTGTAAGG + Intronic
945987615 2:216368012-216368034 TTGAAAAAGTTCACACAGTGGGG + Intronic
946388889 2:219403851-219403873 TTGTCCAAGGTCACACAGTGAGG + Intergenic
948747982 2:240109695-240109717 CTGACCAAGTTCAGCCTTTGTGG + Intergenic
1168964491 20:1891057-1891079 TTGACCAGGGCCACCCTGTGGGG - Intergenic
1170505971 20:17026234-17026256 TTGGCCAAGGTCACTCAGTAAGG - Intergenic
1170652142 20:18252633-18252655 TTCACCAGGTTCAGTCTGGGAGG + Intergenic
1171481310 20:25457917-25457939 TTGCCCAAGTTCACTCAGCTGGG + Intronic
1172641680 20:36443963-36443985 TTGCCCACGTTCACATTGTGAGG + Intronic
1173791024 20:45827778-45827800 TTTACCATGGTCTCTCTGTGAGG - Intronic
1174709063 20:52685986-52686008 TTAAACAAGTTAACTTTGTGGGG - Intergenic
1175309373 20:58000947-58000969 TTGTACAAGTGCACTCTCTGAGG + Intergenic
1179420024 21:41228027-41228049 TTGCCCAAGTTCAAGCTTTGAGG + Intronic
1179452758 21:41476830-41476852 TTGCCCAAGGTCACACTGTGGGG - Intronic
1180319846 22:11309910-11309932 TTGAGCAAGCTCACACAGTGAGG + Intergenic
1182681653 22:32084307-32084329 TTGCCCAAGGCCACTCAGTGAGG + Intronic
1182684849 22:32114106-32114128 AGGACCAACTTCACTCTGTAGGG + Intergenic
1182740358 22:32562949-32562971 TTGCCCAAGGTCACCCAGTGAGG - Intronic
1183253887 22:36748220-36748242 TTGTCCAAGGCCACTCAGTGAGG + Intergenic
1183394543 22:37563792-37563814 TTGCCCAAGGTCACATTGTGAGG + Intronic
1184586995 22:45454617-45454639 TTGACCAAATTCAGCCTCTGAGG + Intergenic
1184734620 22:46390841-46390863 TTGACTGTGTCCACTCTGTGAGG - Intronic
950116263 3:10452146-10452168 TTGCCCAAGGTCACACAGTGGGG + Intronic
950512557 3:13440172-13440194 GTGACCAGGCTGACTCTGTGTGG - Intergenic
954014001 3:47669847-47669869 GTCACCAAGTCCACTCTATGTGG + Intronic
963996039 3:151709640-151709662 TTGACCCAGTGCAGTCTCTGTGG + Intergenic
964672921 3:159246935-159246957 TTAACAAAGTTCATTCTGTTTGG - Intronic
982325372 4:154124211-154124233 TTGATGAAGACCACTCTGTGAGG - Intergenic
982325540 4:154125401-154125423 TTGATGAAGACCACTCTGTGAGG + Intergenic
982984116 4:162182885-162182907 TTGTCCAAGGTCAGTCAGTGTGG + Intergenic
983908850 4:173214393-173214415 TTGGCCCAGATCACTCTGTAAGG + Intronic
985654549 5:1123191-1123213 GTGCCCAAGGTCACTCTGTGGGG + Intergenic
986111723 5:4725632-4725654 TTGCAGAGGTTCACTCTGTGGGG - Intergenic
990526106 5:56629172-56629194 GTGCCCCAGTACACTCTGTGTGG - Intergenic
993813678 5:92513985-92514007 TAGACCAAGCTCACTTTGTGTGG - Intergenic
995172565 5:109134572-109134594 TTACCCAAGTTAAATCTGTGTGG - Intronic
996496582 5:124164162-124164184 GTTACCAAGCTCACTGTGTGAGG + Intergenic
996497389 5:124175486-124175508 TTGTCCAAGTTCTCTCTATCAGG + Intergenic
999639506 5:153658065-153658087 TTGGCCAAGGTCACACAGTGAGG + Intronic
1000359473 5:160433868-160433890 ATGTCCAAGTTCACTCTGGCTGG - Intergenic
1000917244 5:167097219-167097241 TTGATCGAGTGCATTCTGTGCGG + Intergenic
1002762908 6:215629-215651 TTGACCAAGTTTGCACTTTGGGG - Intergenic
1003052456 6:2792406-2792428 TTGACCAAGGTCACGGGGTGAGG - Intergenic
1003291729 6:4785210-4785232 TTGTGTAAGTTCACTCTGTGAGG + Intronic
1009560341 6:65233375-65233397 TTGACTGAATTAACTCTGTGAGG + Intronic
1013492023 6:110657145-110657167 TTGACCAAGTTCACTCTGTGCGG + Intronic
1014455412 6:121627985-121628007 TTGACCCAGTTCAGTGCGTGTGG - Intergenic
1014610976 6:123546091-123546113 TTGACTATGTTCACTCTCTATGG + Intronic
1019756094 7:2771325-2771347 CTGGGCAAGTTCACTATGTGCGG - Intronic
1022237599 7:28477144-28477166 TTGAACAAGTTCACTGTGATGGG + Intronic
1024119895 7:46226063-46226085 TTGAACCAGATCAATCTGTGTGG + Intergenic
1024143726 7:46488900-46488922 TTGACCAAGTTATTTCTCTGGGG - Intergenic
1027646613 7:80809291-80809313 TTAGCCAAGTTCATTCTCTGTGG - Intronic
1028279771 7:88908039-88908061 TTTACCAAATGCACTCTGAGGGG + Intronic
1028631028 7:92934174-92934196 TTGAACAAGTTCATTCTGACTGG + Intergenic
1030033116 7:105387699-105387721 TTGAGCAAGAATACTCTGTGTGG - Intronic
1030694952 7:112574911-112574933 TTGACCGAGTTCACTGTTTAGGG + Intergenic
1034097145 7:148419835-148419857 TTGACCAAGGTCACACAGGGAGG - Exonic
1037310680 8:17552517-17552539 TAGACCAACTTCACTCTGATTGG - Intronic
1037310686 8:17552603-17552625 TAGACCAACTTCACTCTGATTGG - Intronic
1039349232 8:36743133-36743155 TTGGCCAAGTGCTCTCAGTGTGG + Intergenic
1039451564 8:37679100-37679122 TTGACCAAGCTCACTCTGCCAGG + Intergenic
1041537310 8:58941410-58941432 TTGTCCAAGTTCACTCAGCTTGG + Intronic
1045443171 8:102235516-102235538 ATGACCTAGTTGACTTTGTGAGG - Intronic
1046480384 8:114809333-114809355 TTGACCCAATTCTCTCTGTGAGG + Intergenic
1049931627 9:462890-462912 TTGCCCAAGATAACACTGTGAGG - Intronic
1053286708 9:36854474-36854496 TTGTCCAAGGTCACTCTAAGAGG - Intronic
1053388678 9:37716923-37716945 TTTGGCAAGTTCACTCTCTGGGG + Intronic
1055562195 9:77532168-77532190 TTGTCCAAGGTCACTCAGTTTGG + Intronic
1056232884 9:84565035-84565057 TTGCCCAAGGTCATTCAGTGAGG - Intergenic
1203368076 Un_KI270442v1:275669-275691 TTGAGCAAGCTCACACAGTGAGG + Intergenic
1186381629 X:9067029-9067051 TTGGCCAAGATCACAGTGTGAGG + Intronic
1188564910 X:31515700-31515722 TTGACCAGGGTCACACAGTGTGG + Intronic
1190875891 X:54459817-54459839 TTGGCCAAGCTCAAGCTGTGAGG + Intronic
1192546859 X:72021560-72021582 TTGTCCAAGGTCACACAGTGAGG + Intergenic
1192748008 X:73959192-73959214 TTCACCAATTTCACACTGTCTGG + Intergenic
1193798708 X:85909457-85909479 TTAACCAATTTCACTTTCTGAGG + Intronic
1196184866 X:112735255-112735277 TTGACCAATTTCCCTCTTTCTGG - Intergenic
1198927926 X:141820750-141820772 TTGAGCAAGGTAACTCTTTGGGG + Intergenic
1199204154 X:145128202-145128224 TTGACCAAGTCCATTCTGTTTGG - Intergenic