ID: 1013497799

View in Genome Browser
Species Human (GRCh38)
Location 6:110715781-110715803
Sequence AAGTTTCTGCCGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013497799 Original CRISPR AAGTTTCTGCCGAAGATGGC AGG (reversed) Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902265457 1:15260251-15260273 AAGTTGCAGCCGAGAATGGCTGG - Intronic
904054117 1:27659144-27659166 GAGGTTGTGCCTAAGATGGCTGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910389495 1:86724077-86724099 AAGTGTCTGGGAAAGATGGCAGG - Intronic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
911044458 1:93617134-93617156 ATGTGTCTGCTGAATATGGCTGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911664196 1:100535546-100535568 AAGTTCCTGCTGAAGGTGGGAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
914432974 1:147636357-147636379 ATCTTCCTGCCAAAGATGGCAGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920556353 1:206907604-206907626 AGGCGGCTGCCGAAGATGGCGGG + Intronic
920567968 1:206991080-206991102 CTGTTTCTTCCGAAGATGTCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063017503 10:2093592-2093614 ACGTTTCTGCTGAAGGTGACTGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067253017 10:44605171-44605193 AAGTTTCTGCCAAAGCCTGCTGG + Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070298046 10:75181617-75181639 AAGTTTGTGCCTGATATGGCAGG + Exonic
1070821551 10:79358461-79358483 AAGATTCTTCAGAATATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073106687 10:101036336-101036358 AAGTTTACGCCGGAGATGGAGGG + Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077594256 11:3518064-3518086 AAGTTTTTGCTGAAGCTGGATGG + Intergenic
1080354406 11:31425165-31425187 AAGTTTTTGCTGCAGATGGAAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101413435 12:104488235-104488257 ATGTTGCTGCCCAAGATGGCAGG + Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1106822742 13:33484172-33484194 AAATTTCTCCCAAAGTTGGCTGG - Intergenic
1106870231 13:34011447-34011469 AAGAATCAGCCGAATATGGCCGG + Intergenic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1122079185 14:99255099-99255121 AAGTTGCTGCCCAAGTAGGCAGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127418062 15:58776569-58776591 AAGATTCTGCTGAAAATGACAGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132380993 15:101366658-101366680 AATTTCCTGCAGAAGGTGGCTGG + Intronic
1133927191 16:10202792-10202814 AAGATTCTGCCCACCATGGCAGG - Intergenic
1135924241 16:26678340-26678362 GAGTTTCTGCAGTTGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141322185 16:83021576-83021598 AGGTTTCTGCTGAAGATTGTTGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141786376 16:86203549-86203571 CAGCTTCTCCCTAAGATGGCGGG + Intergenic
1144436004 17:15241561-15241583 TAGTTTCTGCTGAAAATGACAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1150140302 17:62722730-62722752 CATTTTCTACAGAAGATGGCTGG - Intronic
1150300498 17:64043685-64043707 AAGTTTATCCAGTAGATGGCTGG + Exonic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151855446 17:76718276-76718298 CAGGTTCTGCAGAAGATGCCGGG + Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1162860360 19:13502032-13502054 AAGGTACTGCCGTAGAGGGCAGG - Intronic
1166431671 19:42733026-42733048 AAGTTGCTGCTGGAGATGGAGGG + Exonic
1166447643 19:42872009-42872031 AAGTTGCTGCTGGAGATGGAGGG + Exonic
1166452097 19:42910822-42910844 AAGTTGCTGCTGGAGATGGAGGG + Exonic
1166464350 19:43019012-43019034 AAGTTGCTGCTGGAGATGGAGGG + Exonic
1166470506 19:43075596-43075618 AAGTTGCTGCTGGAGATGGAGGG + Exonic
1166484105 19:43198239-43198261 AAGTTGCTGCTGGAGATGGAGGG + Exonic
1167116750 19:47493013-47493035 AAGTGTCTGCTGAAGGTGGCTGG - Exonic
1167313312 19:48750097-48750119 AAGCTTCTCCAGAAGATGCCAGG + Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925409784 2:3633264-3633286 AAGTCTTTCCCGAAGATGGGAGG - Intronic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928245995 2:29627401-29627423 AAATTTCTGCATTAGATGGCTGG + Intronic
932355752 2:71067638-71067660 GGGTTTCTCCAGAAGATGGCAGG + Intronic
933741570 2:85538520-85538542 ATGGCTCTGCTGAAGATGGCCGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944209963 2:197197063-197197085 TAGTTTCTGCCTGAGATGACTGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947596826 2:231418263-231418285 AAGAATCTGCCAAAGATGGCCGG + Intergenic
948246708 2:236492429-236492451 AAGTGTATGCTGAGGATGGCAGG - Intronic
948484718 2:238273030-238273052 AAGTTTCTTTCTAAAATGGCAGG - Intronic
1172446952 20:34998224-34998246 AAGTTTGTGCATCAGATGGCAGG - Intronic
1175406872 20:58740710-58740732 GTGTTTCTGCTGAAGAGGGCAGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177733358 21:25058068-25058090 AACTTTCTTCCTAAGGTGGCAGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178054064 21:28779671-28779693 AAGTTTCTGGGAAACATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178412064 21:32372611-32372633 AGGTTTCTGCCGAAGAAGCAGGG - Exonic
1178439290 21:32585251-32585273 ATGTTTCTGCGGAAGTGGGCTGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184990021 22:48161100-48161122 AAGGTTTTGCAGAAGATGACAGG + Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950614505 3:14148194-14148216 CAGATTCTGCCGAAGAAAGCTGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956436180 3:69236579-69236601 AAGGTTCTGCCGAAAATGACTGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960284226 3:115809413-115809435 AAGTTGCTGGGGGAGATGGCGGG - Exonic
962560500 3:136601516-136601538 AAGTTTCAGCCGAAGACAGCTGG + Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969636841 4:8374284-8374306 AAGTGTCTGCCAGAGAGGGCGGG - Intronic
969745390 4:9066896-9066918 AAGTTTTTGCTGAAGGTGGATGG - Intergenic
971583168 4:28369147-28369169 AAGATACTGCTGAGGATGGCTGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976531266 4:86155220-86155242 GAGTTTCTGCTGAACATGCCTGG + Intronic
976657069 4:87499794-87499816 TAGGTTCTGCCGAACATGGCCGG - Intronic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
981833266 4:149026649-149026671 AAGGTTATGCCCAAGATAGCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983332868 4:166353775-166353797 AAGTCACTCCCAAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985750520 5:1671433-1671455 AAGTTTCTCCAGCATATGGCTGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998028764 5:138845040-138845062 AAGTTACTGCCGAAGGAGCCAGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008658074 6:53636250-53636272 ATGTATTTGCCCAAGATGGCAGG + Intergenic
1008786668 6:55175907-55175929 AAGTCTCTGCTGAAAATGACAGG + Intronic
1008868032 6:56238657-56238679 AGGTATCTGCTGAAGGTGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010252511 6:73722636-73722658 AAGTTCCTATCGAAGATGGCAGG - Intronic
1010431699 6:75784824-75784846 AAGTATCAGCTGAAGATTGCGGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013497799 6:110715781-110715803 AAGTTTCTGCCGAAGATGGCAGG - Intronic
1013867567 6:114717463-114717485 AAGTTTCTTCAGAAGGTGTCTGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015816480 6:137216901-137216923 AAGTTTCTGCAGAATATAGAAGG + Intronic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017850651 6:158302674-158302696 AAGTTACTGTAGAAGAGGGCTGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1036249570 8:7150198-7150220 AAGTTTCTGCTTAAGCTGGATGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039424852 8:37477365-37477387 AAGTGTCTTCCAAGGATGGCTGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045001209 8:97879663-97879685 AAATTTCTGGCCTAGATGGCTGG + Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1047372588 8:124268119-124268141 AAGTTTCTGCAGCAGATGGCAGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052092472 9:24346165-24346187 TAGTTGCTGATGAAGATGGCAGG - Intergenic
1053319541 9:37083399-37083421 AAATTTCTGCCCAAAATGTCAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1061052523 9:128204734-128204756 GAGTTTCTGAAGAAGATGGGGGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185686797 X:1935518-1935540 AAGTTGCTGTCGAAGACGGGTGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1190826469 X:54022512-54022534 AAGTTCCTGGTGAAGATGGATGG + Intronic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192746141 X:73941057-73941079 AAGTGCCTGCCAAATATGGCTGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic