ID: 1013502496

View in Genome Browser
Species Human (GRCh38)
Location 6:110766612-110766634
Sequence GCAGCATCATTGACCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013502496 Original CRISPR GCAGCATCATTGACCCTGCA GGG Intronic
900993777 1:6109597-6109619 GCAGCCTCAGTTTCCCTGCAGGG + Intronic
901078952 1:6572825-6572847 GCCACATCATGGACCCAGCAAGG + Intronic
905340986 1:37277384-37277406 GCACCATCACTGAGCCTCCAAGG - Intergenic
905874000 1:41420667-41420689 TCACCCTAATTGACCCTGCAGGG + Intergenic
907239723 1:53074767-53074789 GCAGCAACAAGGACCCAGCAGGG - Intronic
907372491 1:54012300-54012322 GCACCACCCTTGACCCTCCAGGG - Intronic
907491323 1:54810638-54810660 GGAGCAGCAGTGACCCCGCATGG + Intronic
910047976 1:82940387-82940409 GCAGAATCATGGAACTTGCAAGG + Intergenic
910168135 1:84349328-84349350 GCAGCATCTTTGATCCTTAAGGG + Intronic
911983141 1:104590757-104590779 GCTTCATCAATGCCCCTGCAAGG - Intergenic
914343568 1:146779680-146779702 GCACCATCCTGGGCCCTGCAGGG - Intergenic
917609951 1:176678707-176678729 GCAGAATCAATGACACTGCTAGG + Intronic
921801301 1:219405762-219405784 GCAGCATCAAAGACCTTCCAAGG + Intergenic
921835331 1:219772462-219772484 GCAACCCCATTGGCCCTGCATGG + Intronic
922035500 1:221844028-221844050 CCAGAATCATTGACATTGCAAGG - Intergenic
1062789150 10:290515-290537 TCAGCATCATTGTCCTGGCATGG - Intronic
1063246558 10:4225754-4225776 ACAGCATCATTGTCTCTCCATGG + Intergenic
1063440921 10:6072245-6072267 GCAGGATCCTTGAGCCTGGAAGG + Intergenic
1064811406 10:19203357-19203379 GAGGCATCATTGTTCCTGCAGGG - Intronic
1069627921 10:69879900-69879922 TCAGCATCCCTGACCCTGAAAGG - Intronic
1070598453 10:77849229-77849251 ACAGCACCATTTACCCTGCAAGG + Intronic
1071334708 10:84591172-84591194 GCATCATCTTTGACAGTGCAGGG - Intergenic
1072722179 10:97787825-97787847 GGAGCCTCATTGTCCCTGGAAGG + Intergenic
1073576612 10:104631242-104631264 GCCCCATCATTGGCCCTGGACGG + Intergenic
1073997540 10:109333068-109333090 GAAGCATTATAAACCCTGCAAGG + Intergenic
1075020069 10:118945512-118945534 CCTGCATCTTTGACGCTGCATGG + Intergenic
1075928422 10:126272211-126272233 ACAGTATAATTGACCCTGGAGGG - Intronic
1077311825 11:1892176-1892198 GCAGCATCAAGCATCCTGCATGG - Exonic
1078088601 11:8249694-8249716 GCATCATCAGTGAGGCTGCAGGG - Intronic
1079034346 11:17009219-17009241 GCAAAATCATTGAACCTTCATGG + Intronic
1080144149 11:28959358-28959380 GCAGCCACATTGACACTTCAAGG + Intergenic
1080749210 11:35137491-35137513 GCAGCATATTTCACCTTGCATGG + Intergenic
1081669643 11:44935840-44935862 GCAGCAGCATTGAGTCTGGAGGG - Intronic
1085307954 11:75498880-75498902 CCAGCATCTTTGCCCCTGGAGGG + Intronic
1085451755 11:76638390-76638412 GCAGCAGCTCTGACCCTGCGGGG - Intergenic
1086189291 11:84059470-84059492 ATACAATCATTGACCCTGCAAGG + Exonic
1090915321 11:131157797-131157819 GCAGGACCATTGACACAGCAGGG + Intergenic
1092269778 12:7014276-7014298 GCAGTATTCTTAACCCTGCAAGG - Intronic
1092532365 12:9355106-9355128 GCTTCATCAATGTCCCTGCAAGG + Intergenic
1102840330 12:116113577-116113599 GCCGCAACCTTGACCCTGCTAGG - Intronic
1104288517 12:127447245-127447267 GTAGCATCATTGACCCTGATTGG + Intergenic
1104752811 12:131250794-131250816 GCAGCATTGCCGACCCTGCATGG - Intergenic
1106146609 13:27054900-27054922 GCAGCTTCCCTCACCCTGCACGG - Intergenic
1108786336 13:53906647-53906669 GCAGAATCAATGACACTGCTAGG - Intergenic
1108802420 13:54115979-54116001 GCAGCATCATTGACAATGACAGG + Intergenic
1110093890 13:71490646-71490668 GCAGCATCCCTGCCCCTGCATGG - Intronic
1115193018 14:30767638-30767660 AAAGCATCATTGATCCTGCTGGG + Intergenic
1118456934 14:65953174-65953196 GTGGCATCATTGTCCATGCAGGG + Intergenic
1118482523 14:66181282-66181304 GTGGCATCATTGTCCATGCAGGG - Intergenic
1119771539 14:77223144-77223166 GCAGCAACATCTACCTTGCAAGG + Intronic
1121515316 14:94545706-94545728 GCAGCACCATAGAAACTGCAAGG - Intergenic
1122064887 14:99165908-99165930 GCAGTATCACAGACCCTGCTGGG - Intergenic
1122134353 14:99624362-99624384 GCAGCAGCACTGACCCCACAGGG + Intergenic
1124051830 15:26203628-26203650 GCATCACCATTGAATCTGCAAGG - Intergenic
1126790315 15:52215457-52215479 ACAGCTGCAGTGACCCTGCATGG - Intronic
1127640420 15:60910991-60911013 GGAGAATCATTGAACCTGGAAGG - Intronic
1129754540 15:78089427-78089449 CCAGCATCATTCACCATGGAAGG + Intronic
1132248369 15:100315236-100315258 GAAGCAGCAGTGCCCCTGCACGG - Intronic
1138127086 16:54447925-54447947 GCACCAGCATTGATCCTGCCGGG - Intergenic
1138345968 16:56320393-56320415 GCACCATCATTTTCTCTGCAAGG - Intronic
1139224662 16:65222536-65222558 GCAGAATCAGAGACCCTTCAGGG + Intergenic
1139990423 16:70935654-70935676 GCACCATCCTGGGCCCTGCAGGG + Intronic
1140736309 16:77900974-77900996 TCAGCATCATTGACAGAGCAAGG + Intronic
1141327433 16:83075063-83075085 CCAGCATCCTTGACCCTTAATGG + Intronic
1142279710 16:89141511-89141533 GCAGCAGGATGGACCCTGGAGGG + Intronic
1142427996 16:90010991-90011013 GCTGCTTCCTGGACCCTGCATGG + Intronic
1146576035 17:33992421-33992443 TCAGCTTCCTTGACCCTGCCAGG + Intronic
1146689184 17:34861358-34861380 TCAGCACCCTTGTCCCTGCAAGG - Intergenic
1149537919 17:57446691-57446713 GGAACATCATTGACTCTGAATGG + Intronic
1161587515 19:5113646-5113668 GGAGCATCCTGGGCCCTGCAGGG + Intronic
1166480099 19:43164295-43164317 GGAGAATCATTGAACCTGCGAGG + Intronic
925211891 2:2056447-2056469 GCAGCATCATATACCCTGCAAGG - Intronic
925215098 2:2087474-2087496 GCAGCATAGATGAACCTGCAGGG - Intronic
927303249 2:21540171-21540193 GCAGCCTCATTGTCACTGCTGGG - Intergenic
932421478 2:71604002-71604024 GCAGCCTGCTTGGCCCTGCAGGG - Intronic
933200694 2:79444756-79444778 GGAGCATCAATGTCTCTGCAAGG + Intronic
933318429 2:80742529-80742551 GCACAATCAATGGCCCTGCATGG - Intergenic
934156175 2:89203168-89203190 GCAGAAGGGTTGACCCTGCATGG + Intergenic
934211142 2:89979595-89979617 GCAGAAGGGTTGACCCTGCATGG - Intergenic
936136455 2:109898578-109898600 GCAGCAGCAGTGACCCTGGCGGG + Intergenic
936148062 2:109994973-109994995 GCAGGATCATTCACCTTCCAAGG - Intergenic
936196630 2:110376474-110376496 GCAGGATCATTCACCTTCCAAGG + Intergenic
936208242 2:110472907-110472929 GCAGCAGCAGTGACCCTGGCGGG - Exonic
936284465 2:111171566-111171588 GCAGCATCCTTGAAGCTGCAGGG + Intergenic
936784477 2:116077387-116077409 ACAGCATCATTGACCTTAAAAGG + Intergenic
937660851 2:124428231-124428253 GGAGAAACATTGACCCTGCCTGG + Intronic
937847804 2:126601009-126601031 ACAGCATCATAGCACCTGCAGGG + Intergenic
937969594 2:127538953-127538975 GTAGCATCACTTACCTTGCAGGG + Intronic
939259964 2:139794299-139794321 GCAAAATCCTTGTCCCTGCAGGG - Intergenic
939424037 2:142010894-142010916 GCAGCATAATTGAACCTTCCTGG - Intronic
947407806 2:229798934-229798956 GCAACAACATTGAGCCAGCACGG - Exonic
948846419 2:240684805-240684827 GCATCTGCATTGACCCTCCACGG + Intergenic
948847443 2:240689928-240689950 GCATCTGCATTGACCCTCCACGG - Intergenic
1169559377 20:6783298-6783320 TCAACACCATTGAGCCTGCAGGG + Intergenic
1170072884 20:12387960-12387982 GGCGCATGATTGACCTTGCAGGG - Intergenic
1170290973 20:14767937-14767959 GCATCATCCATGTCCCTGCAAGG + Intronic
1170944039 20:20874203-20874225 GCAGCATTTTGGACCCAGCACGG + Intergenic
1172390339 20:34561136-34561158 GGCCCATAATTGACCCTGCAAGG + Intronic
1178846248 21:36176409-36176431 GCTGCATCTTTCAGCCTGCAGGG + Intronic
1181875325 22:25935940-25935962 GCAGCATCAGTGAACCCGCAGGG - Intronic
950653256 3:14421030-14421052 GATGAATCATTGACCCCGCAGGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955688274 3:61565250-61565272 GAAGCATTATTAACCCTGAATGG - Intronic
961738148 3:129015182-129015204 GCAGCCACACTGACCCTCCAGGG + Intronic
964271173 3:154958327-154958349 TCTGCTTCATTGACTCTGCAGGG + Intergenic
964515587 3:157504345-157504367 GCAGCATGATTGCCACTGAATGG - Intronic
968468700 4:766327-766349 GGAGCATCACTCTCCCTGCAAGG - Exonic
969249168 4:5955815-5955837 GAAGCATCATTGTCAGTGCAGGG + Intronic
974891730 4:67891901-67891923 GCAGCCTTATTGACCCTGGAGGG - Intergenic
976308952 4:83590981-83591003 GCAGGATAATTGAAGCTGCATGG + Intronic
978648639 4:110972862-110972884 GCAGCAATATAGACCCAGCATGG - Intergenic
979532189 4:121780670-121780692 TCACCATCAATGAACCTGCATGG + Intergenic
985876921 5:2606961-2606983 GCAGCACCAGGGACCCTGCAGGG + Intergenic
988794601 5:34640983-34641005 GCTGCATCCATGTCCCTGCAAGG + Intergenic
990089838 5:52029408-52029430 GCTTCATCCTTGTCCCTGCAAGG + Intronic
994182987 5:96788039-96788061 GCAACTTGATTGACCCTGGATGG - Intronic
994610037 5:102024498-102024520 GCATCATCCATGTCCCTGCAAGG - Intergenic
995188666 5:109298020-109298042 GAAGCATCATGAACCCTGCACGG - Intergenic
1000477687 5:161731690-161731712 GCTCCATCGTTGATCCTGCATGG - Intergenic
1007466568 6:42056250-42056272 GCAGCATCATTTGCCCTTCTGGG - Intronic
1007590367 6:43017226-43017248 GCAGCATGGTTCACCCTGCGGGG - Exonic
1011598201 6:89036646-89036668 GCACCATCATTGGCCGGGCACGG + Intergenic
1013502496 6:110766612-110766634 GCAGCATCATTGACCCTGCAGGG + Intronic
1015094128 6:129394618-129394640 CCAGCATGATTCACCCTGCTCGG + Intronic
1016918204 6:149264717-149264739 TCAACATCAGTGACCCTGCAGGG + Intronic
1017263452 6:152414789-152414811 GCAGTATCATTGGTGCTGCAGGG - Intronic
1018386769 6:163311594-163311616 GCTGAAACAATGACCCTGCACGG - Intronic
1018825732 6:167406745-167406767 ACAGAACCATTGCCCCTGCAGGG + Intergenic
1019780634 7:2937791-2937813 GCAACATCACTGACAATGCAGGG - Intronic
1031275026 7:119710662-119710684 TTAGCATCATAGACCCTACATGG - Intergenic
1031672700 7:124569384-124569406 CCAGCCTCTTTGCCCCTGCAAGG - Intergenic
1034627247 7:152503254-152503276 GGAGCATCCTTGATGCTGCAGGG - Intergenic
1035551634 8:532262-532284 CCAGCATCCTTCACCCTGCAAGG - Intronic
1037934318 8:22904376-22904398 GCACCAGCATTAACCCTGCAGGG + Intronic
1039743320 8:40401783-40401805 GCACCATCATGGATCCTGCCAGG - Intergenic
1049587406 8:143438456-143438478 GCAGCCTCACTGAACGTGCAGGG - Intronic
1050966702 9:11813070-11813092 GCAGCATGAATGAGCCTGGAGGG - Intergenic
1052579817 9:30340925-30340947 GCATCATCCATGTCCCTGCAAGG - Intergenic
1054929635 9:70622565-70622587 GAAGCATCATTGGCCATGCTGGG + Intronic
1055608356 9:77995221-77995243 GTAGCATCTTTGAGGCTGCAAGG - Intronic
1061014173 9:127972382-127972404 GCAGGGTCAGTGCCCCTGCATGG - Intronic
1061814787 9:133188217-133188239 GCAGAAGCCTGGACCCTGCAGGG + Intergenic
1190573909 X:51813801-51813823 GCATAAACATTGAGCCTGCAAGG + Intronic