ID: 1013504186

View in Genome Browser
Species Human (GRCh38)
Location 6:110782744-110782766
Sequence GTGTTTAACCTGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013504186_1013504188 -6 Left 1013504186 6:110782744-110782766 CCTTTCTCCATCAGGTTAAACAC 0: 1
1: 0
2: 1
3: 14
4: 125
Right 1013504188 6:110782761-110782783 AAACACCAAATTCTATAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013504186 Original CRISPR GTGTTTAACCTGATGGAGAA AGG (reversed) Intronic
904321841 1:29702933-29702955 ATGTTTGATCTGATGGAGAAAGG + Intergenic
907395086 1:54184058-54184080 GTGTTTGAGCTCAAGGAGAATGG + Intronic
908807965 1:67950176-67950198 GTGTTCACCCTGGTGGAGAGGGG + Intergenic
913032718 1:114926920-114926942 GTGATTATCCTGCTGCAGAAAGG + Intronic
919008242 1:191927666-191927688 ATGTATCACTTGATGGAGAATGG - Intergenic
921084549 1:211776664-211776686 TTGTTTCACATGATGTAGAAAGG - Intronic
1065088709 10:22207637-22207659 GAGTTTAACCTGTAAGAGAAGGG - Intergenic
1065674294 10:28157653-28157675 GGGTGGAACCTGATGGAGAATGG - Intronic
1067533837 10:47093690-47093712 GTGTTTTTCCTGTTGGATAAGGG + Intergenic
1069285267 10:66706598-66706620 TTGTTTAAACTGATGGAAACAGG + Intronic
1072476870 10:95770076-95770098 GTGTTTAAACTGAGTGAGACAGG + Intronic
1079568548 11:21914184-21914206 GTGTTTAAGCTGATTGCTAAAGG - Intergenic
1088553138 11:111035173-111035195 GTGGTTATCCTGACGCAGAAGGG - Intergenic
1089350780 11:117820502-117820524 GTGTTTAAAATGATGGCCAAGGG - Intronic
1089829690 11:121315979-121316001 GTGTTTAACTTCATGATGAAGGG + Intergenic
1091526454 12:1306168-1306190 GTGTTTATCATGAGGTAGAATGG - Intronic
1092900524 12:13055625-13055647 GTGCTTAACCTGCAGAAGAATGG + Exonic
1095339832 12:41076284-41076306 AGGTCTAGCCTGATGGAGAATGG - Intergenic
1095694116 12:45125007-45125029 GTTTTTAACAGGAAGGAGAATGG - Intergenic
1098099208 12:66995765-66995787 GTGTTTAACCTCATGAAGAATGG - Intergenic
1101509394 12:105379390-105379412 GTGTTTAAGCTGAGGAAGGAGGG - Intronic
1110897709 13:80776143-80776165 GTGTTTAAATGAATGGAGAATGG - Intergenic
1113363817 13:109657039-109657061 TTGTTTAATCTGATGGAAGAAGG + Intergenic
1114137078 14:19865626-19865648 GTGTTTAACCATAGGGAGAATGG + Intergenic
1115694953 14:35886960-35886982 GTGATTAAGCCAATGGAGAATGG + Intronic
1116548055 14:46196806-46196828 GTTTATAATCTGATTGAGAAGGG - Intergenic
1118925311 14:70186532-70186554 TTCTTTAACTTGATGGAGAAGGG - Intronic
1119645039 14:76341901-76341923 GCGTAAAACCTGCTGGAGAATGG + Intronic
1121138540 14:91520634-91520656 GTGATTCTCCTGATGGAGGATGG - Intergenic
1123786168 15:23676890-23676912 GTGGTTAAATTGATAGAGAATGG - Intergenic
1130115068 15:80999695-80999717 GTTTTTAACTGGCTGGAGAAAGG + Intergenic
1133162874 16:3923486-3923508 GTGTTTAAACTTTTGGGGAATGG - Intergenic
1133202034 16:4209565-4209587 GTGGGTACCCTGAGGGAGAAGGG - Intronic
1137788809 16:51157195-51157217 GTTTTTTCCCTGATGGAGAGAGG + Intergenic
1138062611 16:53907695-53907717 GTGATTAGACTGATTGAGAAAGG - Intronic
1141314115 16:82944295-82944317 TTGGTTAACCTGGTGGAAAATGG + Intronic
1146249707 17:31328051-31328073 TTGTTTTACATGATGGAGAAAGG - Intronic
1147030585 17:37631761-37631783 GTGTGTAACCCCTTGGAGAATGG - Intronic
1149215788 17:54352504-54352526 GTCTTTAACCTGATAAATAAAGG + Intergenic
1152901513 17:82943737-82943759 GTGTTTGACCTGGTGGCCAATGG + Intronic
1155313502 18:24547837-24547859 GAGCTTCTCCTGATGGAGAACGG - Intergenic
1158565345 18:58550302-58550324 GGGTTTTACGTGATGGAGATGGG - Intronic
1159823429 18:73175467-73175489 ATGCTTAACTTGAAGGAGAATGG - Intronic
1160155480 18:76430561-76430583 ATCTGAAACCTGATGGAGAATGG - Intronic
925249221 2:2416785-2416807 GTGTTTAACCTTCTGTAGAACGG - Intergenic
928735534 2:34284074-34284096 GTGATTTTCCTGATGGAAAATGG + Intergenic
929639125 2:43558495-43558517 GTGTTTACCCAGGTGGAGGATGG - Intronic
931182393 2:59915853-59915875 GTGTATAATCTGTTGAAGAAGGG - Intergenic
932062601 2:68522736-68522758 CAGTTCAAACTGATGGAGAAAGG + Intronic
933389861 2:81655398-81655420 GTGTTTAGCTTGATGTGGAAAGG + Intergenic
936472188 2:112809009-112809031 GTGTGTAATGTGAGGGAGAAGGG + Intergenic
936970804 2:118174881-118174903 AGGTTTGACCTGATGGAGAAAGG + Intergenic
937659586 2:124415175-124415197 CTCTTTATCCAGATGGAGAATGG - Intronic
937859369 2:126696176-126696198 GTATTTTTCCTGATGGAGATGGG - Exonic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938469952 2:131550597-131550619 GTATTTAACCTTTTGAAGAATGG - Intergenic
940446062 2:153778431-153778453 TTCTTTAAAATGATGGAGAAGGG - Intergenic
940912830 2:159224232-159224254 GTGCTGTACCTGGTGGAGAAGGG + Exonic
941140530 2:161775054-161775076 GTGTTGCATCTGAGGGAGAATGG + Intronic
941233721 2:162943295-162943317 GTATTTAACCTGAGGGTGGAGGG - Intergenic
941464084 2:165804829-165804851 GTGTTTCACAAGATGCAGAAAGG - Intergenic
942716246 2:178895862-178895884 GTGTTTGTCTTGTTGGAGAATGG + Intronic
945440717 2:209875767-209875789 GTGTTTTGACTGATGGAGAATGG - Intronic
946535119 2:220619386-220619408 GTGTAGAAGCTGATGTAGAAAGG + Intergenic
1169608745 20:7354361-7354383 ATGTTGAAACTAATGGAGAAAGG + Intergenic
1170480745 20:16762540-16762562 GTGCTTAAAATCATGGAGAAAGG - Intronic
1170746660 20:19105607-19105629 GGCTTTAACCTGATGGAGGTGGG - Intergenic
1173080947 20:39866922-39866944 TTTTGAAACCTGATGGAGAAGGG - Intergenic
1181464487 22:23103523-23103545 GTGTTTACCCCGCTGGAGAAAGG + Intronic
1182078207 22:27509578-27509600 GTGTTTCTCCAGGTGGAGAAGGG - Intergenic
1184542253 22:45134200-45134222 GTGTTTTACCAGAAGGTGAAGGG - Intergenic
949755566 3:7406787-7406809 GTATTTATCCTAATGGAAAAAGG - Intronic
950809428 3:15636815-15636837 GTGTATAACATGATGTTGAAAGG + Intronic
951686599 3:25351202-25351224 GTCTTTCACTTGATGGAGAGGGG + Intronic
952440175 3:33318950-33318972 GTGTGTTTCCTGAAGGAGAAGGG + Intronic
953870367 3:46620946-46620968 TTGTTTAACATGCAGGAGAAGGG + Intronic
954589798 3:51773557-51773579 GTGTCTAACCTCAAGGAGAAGGG - Intergenic
956061012 3:65348351-65348373 GGGTTAAAGCTGATGGACAAGGG + Intergenic
961905836 3:130262149-130262171 AGGTTTAACCAGATGCAGAAGGG - Intergenic
964467531 3:157012638-157012660 CTGTGTACCCTGATGGACAAGGG - Intronic
967234452 3:187370726-187370748 GTTGTTAACCTGAGGGAAAATGG - Intronic
970263609 4:14256232-14256254 GTGATTGACAGGATGGAGAATGG + Intergenic
972963632 4:44484279-44484301 GTCTGCAACATGATGGAGAATGG - Intergenic
973811842 4:54578597-54578619 GTGTTTAACTTGCTCGATAATGG + Intergenic
973867360 4:55126662-55126684 GTGTTTATCTTGGTGAAGAATGG - Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
979963730 4:127052060-127052082 GTGTGTATCCTGATGGACAGAGG - Intergenic
980534436 4:134097957-134097979 TTGTTTATCCTGATAGGGAAAGG + Intergenic
982753656 4:159192382-159192404 GTGTTTCACAGGTTGGAGAATGG + Intronic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
984405336 4:179321867-179321889 GAGTTTAACCTGAAGAAGTATGG - Intergenic
987248072 5:16069813-16069835 TTGTTTTATCTGATGGAAAAAGG - Intronic
988335405 5:29901908-29901930 GTGATTAATTTTATGGAGAAAGG - Intergenic
988469047 5:31519692-31519714 GTCTTTAACATGATGAAGAATGG - Intronic
988508384 5:31843935-31843957 GTTTTTCAGCTGATGGAGAATGG + Intronic
989476146 5:41875400-41875422 ATGTTTAAATTGAGGGAGAATGG - Intergenic
993887930 5:93438733-93438755 CTGTTTCACCTGAGGGGGAAAGG + Intergenic
994011589 5:94910396-94910418 TTGTTTAACCCAATGGTGAATGG - Intronic
994689838 5:103004064-103004086 GTGCTTAAGCAGATGGAGAAGGG - Intronic
994697153 5:103086623-103086645 GTGTTTATCCTTATGGAAGAAGG - Exonic
995584295 5:113631185-113631207 ATCTTTAACCTGATGCAGTAAGG + Intergenic
995995899 5:118299069-118299091 GTTTCTAACCAAATGGAGAAAGG + Intergenic
999128384 5:149264005-149264027 CTGTTCTACCTGATGGAAAAGGG + Intergenic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
1000035122 5:157440976-157440998 GTGTTTAACCTAATCTAGACTGG - Intronic
1003303770 6:4908263-4908285 CTGGTTAACCTGATGGGAAAGGG + Intronic
1003853220 6:10246015-10246037 GTATTTCATCTCATGGAGAAAGG + Intergenic
1003995188 6:11533335-11533357 CTCTTAAATCTGATGGAGAAGGG + Intergenic
1004692524 6:18004650-18004672 TTGTGGAACCTGGTGGAGAAAGG + Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1005777308 6:29149189-29149211 GTGTTGAACTTGTTGGACAAAGG - Intergenic
1012267420 6:97162670-97162692 GTCTTTAACTTGCTGGAGGAAGG - Intronic
1013504186 6:110782744-110782766 GTGTTTAACCTGATGGAGAAAGG - Intronic
1013773656 6:113654490-113654512 GTGCTTAAGCCAATGGAGAAGGG - Intergenic
1013839463 6:114373034-114373056 GTTTTTATCCTAATGGAAAAGGG + Intergenic
1017582729 6:155884155-155884177 GTGTTTATTCTAAGGGAGAAAGG + Intergenic
1020916530 7:14200789-14200811 GTGTTTAACTCTATGGAGGATGG + Intronic
1021958948 7:25853116-25853138 GTGTTTAAACAAATGGAGATGGG - Intergenic
1024224856 7:47318712-47318734 CTGATTATCATGATGGAGAATGG + Intronic
1027476750 7:78641247-78641269 ATGTTTAACCTCCTGGAAAAAGG + Intronic
1032382068 7:131495626-131495648 GTTTTTTACCACATGGAGAAAGG + Exonic
1033352937 7:140577056-140577078 GTGGTCACCCTGCTGGAGAAAGG + Intronic
1034958198 7:155349019-155349041 CTGTCTGACCTGGTGGAGAATGG + Intergenic
1043742007 8:83825839-83825861 GTCTTTAGCCTGAAGGAGACTGG - Intergenic
1048401643 8:134076772-134076794 GTGTTTAAAATGTTGAAGAATGG - Intergenic
1049017415 8:139930649-139930671 GTGTTTAGCCCCATGGAGGAGGG + Intronic
1051403991 9:16714172-16714194 GTGTTTAAACTTTTTGAGAATGG - Intronic
1053510648 9:38685274-38685296 GTGTTCAACCTCATTGACAATGG - Intergenic
1058622561 9:106898730-106898752 GAGTTTGCCATGATGGAGAATGG + Intronic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1062403980 9:136385371-136385393 GTGTTTAACCTTTTGAGGAATGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189402216 X:40680797-40680819 TTCTTGAAGCTGATGGAGAATGG + Exonic
1190518596 X:51251975-51251997 GTTTTTAATATGATGGATAATGG + Intergenic
1190993506 X:55579450-55579472 ATGTTTAAGGTGATGGATAATGG - Intergenic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1194568998 X:95529942-95529964 GTCTTTAACATGATGAAGAAGGG + Intergenic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1196049466 X:111289699-111289721 ATGTTTACCCTAATGGAGAGAGG - Intergenic
1196662611 X:118283298-118283320 GAGATTATCCTGATGGAGATGGG + Intergenic
1198362935 X:135913752-135913774 GTGATGAACCTGATGATGAAAGG - Intergenic