ID: 1013504738

View in Genome Browser
Species Human (GRCh38)
Location 6:110788268-110788290
Sequence TTTGAGAAGCTGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7848
Summary {0: 3, 1: 49, 2: 494, 3: 2067, 4: 5235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013504738_1013504744 12 Left 1013504738 6:110788268-110788290 CCCTCCTGCCTCAGCTTCTCAAA 0: 3
1: 49
2: 494
3: 2067
4: 5235
Right 1013504744 6:110788303-110788325 CAGGTTTGCATCACCATGCCTGG No data
1013504738_1013504743 -7 Left 1013504738 6:110788268-110788290 CCCTCCTGCCTCAGCTTCTCAAA 0: 3
1: 49
2: 494
3: 2067
4: 5235
Right 1013504743 6:110788284-110788306 TCTCAAATATCTAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013504738 Original CRISPR TTTGAGAAGCTGAGGCAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr