ID: 1013509489

View in Genome Browser
Species Human (GRCh38)
Location 6:110831536-110831558
Sequence CTTCGGAAGGTGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6252
Summary {0: 1, 1: 1, 2: 21, 3: 456, 4: 5773}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013509489_1013509495 -8 Left 1013509489 6:110831536-110831558 CCTCCCACTTTCACCTTCCGAAG 0: 1
1: 1
2: 21
3: 456
4: 5773
Right 1013509495 6:110831551-110831573 TTCCGAAGTGCCGGGATTATAGG 0: 1
1: 51
2: 2441
3: 49547
4: 346956
1013509489_1013509498 19 Left 1013509489 6:110831536-110831558 CCTCCCACTTTCACCTTCCGAAG 0: 1
1: 1
2: 21
3: 456
4: 5773
Right 1013509498 6:110831578-110831600 AACCACCACGCCCAGCCTTGAGG 0: 1
1: 8
2: 74
3: 456
4: 1448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013509489 Original CRISPR CTTCGGAAGGTGAAAGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr