ID: 1013509489 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:110831536-110831558 |
| Sequence | CTTCGGAAGGTGAAAGTGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6252 | |||
| Summary | {0: 1, 1: 1, 2: 21, 3: 456, 4: 5773} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1013509489_1013509495 | -8 | Left | 1013509489 | 6:110831536-110831558 | CCTCCCACTTTCACCTTCCGAAG | 0: 1 1: 1 2: 21 3: 456 4: 5773 |
||
| Right | 1013509495 | 6:110831551-110831573 | TTCCGAAGTGCCGGGATTATAGG | 0: 1 1: 51 2: 2441 3: 49547 4: 346956 |
||||
| 1013509489_1013509498 | 19 | Left | 1013509489 | 6:110831536-110831558 | CCTCCCACTTTCACCTTCCGAAG | 0: 1 1: 1 2: 21 3: 456 4: 5773 |
||
| Right | 1013509498 | 6:110831578-110831600 | AACCACCACGCCCAGCCTTGAGG | 0: 1 1: 8 2: 74 3: 456 4: 1448 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1013509489 | Original CRISPR | CTTCGGAAGGTGAAAGTGGG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||