ID: 1013512703

View in Genome Browser
Species Human (GRCh38)
Location 6:110859022-110859044
Sequence ACTTGGGGTCATGTATCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 4, 3: 14, 4: 110}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013512703_1013512714 17 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512714 6:110859062-110859084 GTGGCCGACAGGGCTCCCTCGGG 0: 1
1: 2
2: 4
3: 30
4: 150
1013512703_1013512712 7 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512712 6:110859052-110859074 AGAAGGCACAGTGGCCGACAGGG 0: 1
1: 0
2: 0
3: 19
4: 203
1013512703_1013512704 -10 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512704 6:110859035-110859057 GACCCCAAGTTCTGCCCAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 195
1013512703_1013512713 16 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512713 6:110859061-110859083 AGTGGCCGACAGGGCTCCCTCGG 0: 1
1: 2
2: 5
3: 12
4: 112
1013512703_1013512708 -2 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512708 6:110859043-110859065 GTTCTGCCCAGAAGGCACAGTGG 0: 1
1: 0
2: 1
3: 23
4: 245
1013512703_1013512716 25 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512716 6:110859070-110859092 CAGGGCTCCCTCGGGCGCGCAGG 0: 1
1: 0
2: 0
3: 19
4: 159
1013512703_1013512717 30 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512717 6:110859075-110859097 CTCCCTCGGGCGCGCAGGCTCGG 0: 1
1: 0
2: 0
3: 45
4: 1006
1013512703_1013512711 6 Left 1013512703 6:110859022-110859044 CCGGCAGATACATGACCCCAAGT 0: 1
1: 1
2: 4
3: 14
4: 110
Right 1013512711 6:110859051-110859073 CAGAAGGCACAGTGGCCGACAGG 0: 1
1: 0
2: 0
3: 19
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013512703 Original CRISPR ACTTGGGGTCATGTATCTGC CGG (reversed) Intronic
906078528 1:43068966-43068988 ACCTGGGGTCAGGGGTCTGCTGG - Intergenic
916647077 1:166797050-166797072 ACTTGGGATAGTATATCTGCTGG - Intergenic
918136824 1:181681231-181681253 AGTTGGGGACATGGATCTGAGGG - Intronic
918722880 1:187876482-187876504 ACTTGGGGTAGTGTTTCTGGAGG - Intergenic
923107512 1:230866045-230866067 ACTTGGGGTCACCTATTTGGGGG + Intronic
1063445873 10:6116344-6116366 CCTTGGGGTCATGTTTCTACTGG + Exonic
1065623492 10:27607613-27607635 ATTTAGGATCATATATCTGCTGG + Intergenic
1065623743 10:27609878-27609900 ATTCTGGATCATGTATCTGCTGG + Intergenic
1065753427 10:28909357-28909379 AATTGAAGTCATGAATCTGCAGG - Intergenic
1068530694 10:58182695-58182717 AGTTGGCTTTATGTATCTGCAGG - Intergenic
1069615042 10:69801664-69801686 ACTTGGGGTTATTTATAGGCAGG - Intergenic
1070522048 10:77262525-77262547 ACTGGGGGTCATGTTTCAACAGG - Intronic
1070982851 10:80664120-80664142 ACTGGTGGTCCTGTACCTGCAGG + Intergenic
1072280081 10:93858002-93858024 CCTTGGGTTCAGGCATCTGCTGG + Intergenic
1073730444 10:106281298-106281320 ACTTGGGCTCCTGTTGCTGCAGG + Intergenic
1074733982 10:116408800-116408822 ATTTTGGTTCATGTTTCTGCAGG + Intergenic
1085002164 11:73048491-73048513 ACTTCTGCTCATGAATCTGCAGG + Intronic
1089115234 11:116089595-116089617 ACTTGGGTGCAGGTATCTGTTGG - Intergenic
1091211514 11:133864859-133864881 ACTTGGGGTCGTATATCTGCCGG + Intergenic
1092730915 12:11533609-11533631 GTTTGGGCTCATGTTTCTGCAGG + Intergenic
1098979762 12:76943782-76943804 TCTTTGGGTCATTTGTCTGCAGG - Intergenic
1099310983 12:81022539-81022561 ACTTGGGGCCTTGTATTTGAGGG + Intronic
1102051217 12:109863445-109863467 AACTGGGGTCAGGCATCTGCTGG - Intronic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1108636322 13:52338656-52338678 ACTTGTGTTCATGTTTCTGTTGG + Intergenic
1108813540 13:54262226-54262248 ACTTTGGCTCATGGTTCTGCAGG - Intergenic
1113594847 13:111523888-111523910 TCTTGAGGACCTGTATCTGCAGG - Intergenic
1113941707 13:114021806-114021828 GCCTGGGGTCATGTAGCTTCTGG - Intronic
1113941720 13:114021867-114021889 GCCTGGGGTCATGTAGCTCCTGG - Intronic
1115741865 14:36397491-36397513 GATTGGGGTGATGTATCTACAGG - Intergenic
1117406073 14:55405532-55405554 ACCTGGGGAAATGTATCTGCTGG - Intronic
1119370224 14:74133979-74134001 AGTTGAGGTCATGACTCTGCAGG - Intronic
1119619973 14:76124697-76124719 CCTTGGGGTCATGTTTCTTGTGG + Intergenic
1119994081 14:79232782-79232804 ACTTGGGTTTGTGTATTTGCAGG - Intronic
1120709855 14:87781722-87781744 ACTTGGGATCTTGAAACTGCTGG + Intergenic
1120872408 14:89349309-89349331 ACTTGAGGTCATATAGCTGTAGG - Intronic
1123886619 15:24733321-24733343 ACTTAGGGTCATGTGTGAGCAGG - Intergenic
1125126734 15:36232323-36232345 AACTGTGGTCATGTATCTGAAGG + Intergenic
1127335531 15:57979829-57979851 ACTTGGGGTCACATATATGCTGG + Intronic
1128467441 15:67924778-67924800 ATTTTGGCTCATGTTTCTGCAGG + Intergenic
1129001158 15:72335463-72335485 ATTTGGGGGCATGTCTCTTCTGG - Intronic
1129199615 15:73991250-73991272 ACTTGGGCTCCTGAATCTCCAGG - Intronic
1129838917 15:78731429-78731451 CCTTGGGCTCATGTTTCTGGAGG + Intergenic
1139237470 16:65355341-65355363 TCTTGTGGTCATTTTTCTGCAGG + Intergenic
1141792726 16:86247814-86247836 AAATGGGATCATATATCTGCTGG - Intergenic
1147210156 17:38868560-38868582 AGATGGGGACAAGTATCTGCTGG - Intergenic
1150503217 17:65671191-65671213 ACTGGGGGTCAGGAATCTGAAGG + Intronic
1152825657 17:82463066-82463088 ACATGGGGTCATGTGTAGGCAGG + Intronic
1156703791 18:39855836-39855858 TATTGGGGTCCTGTAGCTGCGGG + Intergenic
1157819116 18:50752482-50752504 CCTTGGGGTTATGCACCTGCAGG + Intergenic
1159671370 18:71225124-71225146 ACTTGGAGCCATGTATTTTCTGG + Intergenic
1160816360 19:1037765-1037787 ACTTGGGGTCATATATCTGCCGG - Exonic
1161294157 19:3511243-3511265 ACCTCGGGTCTTTTATCTGCAGG + Intronic
1162003537 19:7763445-7763467 TCTTGTGGCCATGTATCTGCTGG - Exonic
1165942477 19:39422049-39422071 ACTTGGGGTCCTCTATGTGAGGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1168084268 19:54033927-54033949 ACTGAGGGTCATGTACCAGCAGG - Intergenic
925347208 2:3179475-3179497 ACTTGCGCTCCTGTATCTGCAGG + Intergenic
927838157 2:26418084-26418106 ACTTGAGGGGATGTATCCGCAGG - Intronic
927977684 2:27351606-27351628 ACTAGGAGGCATGTATTTGCTGG - Intronic
930304349 2:49659476-49659498 ACTTGGAGTCCGGTATCTGAGGG - Intergenic
931112022 2:59121038-59121060 ATTTTGGCTCATGTTTCTGCAGG - Intergenic
931115062 2:59156750-59156772 ACTTCAGGCCATTTATCTGCAGG - Intergenic
931734806 2:65184265-65184287 ACCTGAGGTGATGAATCTGCAGG - Intergenic
932554408 2:72807707-72807729 ACTGGAGGTCATTTATTTGCGGG + Intronic
934487152 2:94725781-94725803 ACTTGGGGTCGTATATCTGTGGG + Intergenic
934488288 2:94738122-94738144 ACTTGGGTTCATATATTTGCCGG - Intergenic
939407241 2:141774257-141774279 ATTTTGGCTCATGTTTCTGCAGG + Intronic
941301947 2:163813542-163813564 ACATGGGTTCAGGTTTCTGCTGG + Intergenic
945297622 2:208186722-208186744 ACTTGGGAGGATGTTTCTGCTGG - Intronic
945888865 2:215407321-215407343 ACTTTTGCTCATGAATCTGCAGG - Exonic
1169418129 20:5434702-5434724 AGTTGGGCTCATGTTTCTTCTGG + Intergenic
1169431947 20:5544266-5544288 GCTTGGAGTCATGTATTTGATGG - Intergenic
1174550647 20:51359158-51359180 ACTTGGCCACATGTAGCTGCTGG - Intergenic
1176839513 21:13827493-13827515 ACTTGGGGTCGTATATCTGTCGG - Intergenic
1178642092 21:34352892-34352914 ACTTTGGCTCATGGTTCTGCAGG - Intergenic
1180578934 22:16810924-16810946 TCGTGGGTTCATGTATATGCAGG - Intronic
1182397427 22:30046380-30046402 ACTTGGGGTCGTATATCTGCTGG + Intergenic
1184458129 22:44622922-44622944 AGTTGGGGTCATGGATGTGCCGG - Intergenic
1185014260 22:48334153-48334175 CCTGGGGGTCATGTATCAGAGGG - Intergenic
1185385335 22:50529294-50529316 ACTTCGGGGCATGGATCTGGAGG - Exonic
952206004 3:31181864-31181886 GCTTGGGGTCGTATATCTGCCGG + Intergenic
955898837 3:63730106-63730128 GGCTGGGCTCATGTATCTGCAGG + Intergenic
955900934 3:63753388-63753410 ACCTGCTGTCATGTATCTGAAGG - Intergenic
957511604 3:81195625-81195647 AATTGGGGTCATTTATTGGCTGG + Intergenic
957598917 3:82306516-82306538 GCTTGGGGTCATCCATCAGCTGG + Intergenic
960036241 3:113105449-113105471 ACTTAGGGTCTTCTATCTACAGG + Intergenic
964370428 3:155994463-155994485 ACATGGGGTAGTGTAGCTGCAGG + Intergenic
967505854 3:190251840-190251862 ATTTTGGTTCATGTTTCTGCAGG - Intergenic
970088873 4:12380556-12380578 ACTTTGGCTCATGGTTCTGCAGG + Intergenic
970720867 4:18987358-18987380 ACTTGGGGCCATGGGTCTCCAGG - Intergenic
973744446 4:53949497-53949519 TCTTGGTGTCATTTTTCTGCTGG + Intronic
974097200 4:57376236-57376258 TTTTGGGGTCATGAGTCTGCTGG + Intergenic
974106969 4:57480841-57480863 TATTTGGCTCATGTATCTGCAGG + Intergenic
976618659 4:87104831-87104853 ACTTGGATTAATGTATCTGTAGG - Intronic
990514484 5:56518951-56518973 ACGTGGGGGCATGGATCTGTGGG - Intronic
996798288 5:127374911-127374933 ACTTGGGGTTATTTACCTGGTGG + Intronic
1000269096 5:159666133-159666155 ACTAGGAGTCATCTATCTGCAGG - Intergenic
1000750409 5:165088681-165088703 ATTTGGGGTTGTGTATCAGCAGG - Intergenic
1000880165 5:166688133-166688155 GATTGGAGTGATGTATCTGCAGG - Intergenic
1001832966 5:174805038-174805060 AATTGGAGTTATGTAACTGCAGG - Intergenic
1002317312 5:178351472-178351494 CCTGGGGGTCATTTCTCTGCTGG - Intronic
1004521154 6:16362102-16362124 ACTGGTGTTCATGTAACTGCTGG + Intronic
1005439055 6:25845516-25845538 ACTTGGGGTTTTGTGTCTCCAGG - Exonic
1011674602 6:89720207-89720229 ACATGAGGTCATGTATCACCTGG - Intronic
1013512703 6:110859022-110859044 ACTTGGGGTCATGTATCTGCCGG - Intronic
1024219804 7:47278564-47278586 ACTGGGGCTCAGGAATCTGCAGG - Intronic
1024834648 7:53502310-53502332 ACTTGGGTTCTTGTCTTTGCAGG + Intergenic
1026108451 7:67439220-67439242 ACTTGGGCCCAGGTACCTGCTGG + Intergenic
1027704799 7:81516178-81516200 ACTTCATGTCATGTATCTTCTGG - Intergenic
1033436030 7:141334475-141334497 ACTTGCAGTCATGTATCTGCAGG + Intronic
1036486156 8:9180902-9180924 ACTTGGAATCATGTTTCTGCAGG + Intergenic
1037611283 8:20478334-20478356 GATTGGGGTGATGTAGCTGCAGG + Intergenic
1038268326 8:26053283-26053305 ACTTGGGGCCATCTACCTCCCGG - Intergenic
1038486511 8:27939143-27939165 ACTTAGGGTTTTGGATCTGCAGG + Intronic
1041491657 8:58439144-58439166 ACTTTGGCTCATGGTTCTGCAGG - Intronic
1041792317 8:61711095-61711117 GCTTGGGGTTATGTAACAGCAGG - Intronic
1042864203 8:73343396-73343418 ATTTTGGGTCATGAATCTGAGGG - Intergenic
1049838144 8:144753722-144753744 ACTTTGGGTCCTGAATCTTCTGG - Exonic
1052029332 9:23610596-23610618 AGGTGGGGGCATGTAGCTGCTGG - Intergenic
1053669498 9:40346242-40346264 ACTTGGGTTCGTATATTTGCCGG + Intergenic
1053670650 9:40358570-40358592 ACCTGGGGTCGTATATCTGTAGG - Intergenic
1053920442 9:42984921-42984943 ACTTGGGGTCGTATATCTGCGGG - Intergenic
1054380631 9:64486262-64486284 ACTTGGGTTCGTATATTTGCCGG + Intergenic
1054381771 9:64498633-64498655 ACCTGGGGTCGTATATCTGTGGG - Intergenic
1054513963 9:66017730-66017752 ACCTGGGGTCGTATATCTGTAGG + Intergenic
1054515116 9:66030049-66030071 ACTTGGGTTCGTATATTTGCCGG - Intergenic
1055454853 9:76462530-76462552 ATTTGGGGTCATTTAACTGCAGG - Intronic
1188598891 X:31936223-31936245 ATTTTGAATCATGTATCTGCTGG + Intronic
1200287190 X:154834602-154834624 GATTGGAGTCATGTATCTGCTGG + Intronic