ID: 1013525089

View in Genome Browser
Species Human (GRCh38)
Location 6:110966556-110966578
Sequence ACCAGGAAGGTGAAGATCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013525079_1013525089 25 Left 1013525079 6:110966508-110966530 CCACAATATCCTATTCAGTATGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG 0: 1
1: 0
2: 2
3: 26
4: 225
1013525083_1013525089 16 Left 1013525083 6:110966517-110966539 CCTATTCAGTATGGGACAGGACT 0: 1
1: 0
2: 5
3: 16
4: 148
Right 1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG 0: 1
1: 0
2: 2
3: 26
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013525089 Original CRISPR ACCAGGAAGGTGAAGATCAT TGG Intronic
902053589 1:13583034-13583056 ACCAGTAAAGTGAGGATTATGGG + Intergenic
903008634 1:20315055-20315077 ACAAGGAAGGAGAAGTTCATTGG + Intronic
904527604 1:31145685-31145707 TCCTGGAACGTGAAGATAATGGG + Intergenic
908616157 1:65925010-65925032 AACAAGGAGGTGGAGATCATTGG + Intronic
909279158 1:73726645-73726667 TCAAGGAAGGTAAAGATGATAGG - Intergenic
909713438 1:78678461-78678483 ACCAAGAAGCTGAAGCTCTTTGG + Intergenic
910595808 1:88979182-88979204 ACCAGGAACTTGAACATCACAGG + Intronic
911667454 1:100569677-100569699 AGCAGGAAGGTAAAGGGCATAGG - Intergenic
912768905 1:112444054-112444076 ATCAGCAATGTGAACATCATAGG - Intronic
912859610 1:113201825-113201847 TCCAGGAACAAGAAGATCATGGG - Intergenic
914242820 1:145863538-145863560 TCCAGAAAGGGGGAGATCATTGG - Intergenic
915613178 1:157012341-157012363 AGCAGGAAAGGGAAGAGCATAGG + Intronic
916599287 1:166276390-166276412 TCCAGGTAGGTGTGGATCATGGG + Intergenic
916671498 1:167025828-167025850 GCCAGGAAGGGGAAGGGCATGGG + Intergenic
916810547 1:168301815-168301837 TCCAGGAACGTGAAGATAATGGG + Intronic
918212070 1:182359934-182359956 ACCAGGAAGGGGCTGAGCATGGG + Intergenic
918974685 1:191467985-191468007 ATCAGGAAGCTCATGATCATTGG - Intergenic
919775259 1:201190318-201190340 ACCAGGAAGGAGGAGACCCTGGG - Intergenic
920798307 1:209161817-209161839 TCCAGGAACATGAAGATAATGGG - Intergenic
920946458 1:210533776-210533798 GCCAGGAAGATCAAAATCATTGG - Intronic
924372240 1:243363145-243363167 ACAAGGAAGCTGCAGGTCATAGG - Intronic
1063113972 10:3060304-3060326 AGCAGGAAGGGGAGGATGATAGG + Intergenic
1063299331 10:4837480-4837502 ACCGGGCTGGTGAAGAACATCGG + Exonic
1063890909 10:10627587-10627609 ACCAGGCAGTTGATGATCTTAGG + Intergenic
1067195532 10:44114727-44114749 ACAGGGAGGGTGATGATCATGGG - Intergenic
1068658655 10:59601141-59601163 AGCATGAAGGTGAAGTTAATCGG - Intergenic
1069330405 10:67285010-67285032 TCCAGGAACATGAAGATAATGGG - Intronic
1069795097 10:71046838-71046860 ACCAGGCACGTGAAGACCATGGG + Intergenic
1070303761 10:75225542-75225564 TCCAGGAACATGAAGATAATGGG + Intronic
1072505074 10:96057631-96057653 ACCAGGAAGGTTCACATCAAGGG + Intronic
1072662300 10:97370441-97370463 ACCAGGAAGGTGAGGCCCAGGGG - Exonic
1075995075 10:126870599-126870621 AATAGGAAAGTGGAGATCATGGG - Intergenic
1077885682 11:6385964-6385986 CCCAGGAATGTGAAGATAAAGGG - Intergenic
1077987706 11:7371058-7371080 ATCAGAAAAGTGAAGATCAATGG - Intronic
1078045277 11:7908420-7908442 TCCAGGAACATGAAGATAATGGG - Intergenic
1078631269 11:13006901-13006923 CCCAGGAAGATGGAGATTATGGG - Intergenic
1079270229 11:18977475-18977497 TACAGGAAGGTGAACAACATGGG - Intergenic
1079547291 11:21647782-21647804 ACCATGACGGTGAAGCTCTTAGG - Intergenic
1086466726 11:87061642-87061664 ACTAGTAAGGCTAAGATCATGGG + Intronic
1086655617 11:89350407-89350429 AACAGGAAGTTAAAGATTATAGG + Intronic
1087444439 11:98230964-98230986 AACAGGAAGTTGAAAATCAGAGG + Intergenic
1088852840 11:113719467-113719489 ATCAGGATGGGGAAGGTCATGGG - Intergenic
1089612301 11:119676354-119676376 TCCAGGAAGTGGAGGATCATAGG + Intronic
1089661648 11:119990029-119990051 ACCAGGAAGCTGAGGCTCAATGG - Intergenic
1090575277 11:128095423-128095445 GCCAGGAACATGAAAATCATTGG + Intergenic
1091467420 12:697324-697346 CCCAGGAACATGAAGATAATGGG + Intergenic
1094737539 12:33252038-33252060 TCCAGGAACGTGAAGATAATGGG - Intergenic
1095690324 12:45081161-45081183 ACTTGGAAGGTGAGGACCATTGG + Intergenic
1098440216 12:70509839-70509861 CCCAGGAACATGAAGATAATGGG - Intergenic
1100565060 12:95787771-95787793 ACCACCAGGGTGAAGATTATTGG + Intronic
1100776353 12:97979256-97979278 ACCAGGAATGTGGAGATGAAGGG - Intergenic
1101424730 12:104578469-104578491 ACCAGAAAGATAAAGATCTTAGG - Intronic
1101797867 12:107992507-107992529 ATCAGGGATGTCAAGATCATTGG - Intergenic
1102259295 12:111434603-111434625 ACCATAAAGGCGAAGATCACTGG - Intronic
1102814869 12:115857635-115857657 CTCAGGAAGGTGAAGTTCATAGG + Intergenic
1103151131 12:118639831-118639853 ACCAGGAATGTGCATATGATTGG + Intergenic
1107093904 13:36514577-36514599 ACCAGGAAAGAGAAGAGCAGAGG - Intergenic
1108007702 13:45968442-45968464 AGCAGGAAGGTTAAAATCATAGG + Intronic
1108299948 13:49063630-49063652 TCCAGGAAAATGAAGATAATGGG + Intronic
1109605707 13:64692620-64692642 AGCAGGAAGGAGAAGATTGTGGG + Intergenic
1109986965 13:69999293-69999315 TACCGGAAGGCGAAGATCATCGG + Intronic
1111088291 13:83405968-83405990 ATCAGGAAGGGGATGATCAGTGG - Intergenic
1111553344 13:89846366-89846388 ACCAGGAAGATGAAGATGTGAGG - Intergenic
1111995991 13:95166859-95166881 ACCGTGAAGGTGCAGTTCATGGG - Intronic
1113242566 13:108354799-108354821 AGCAGGAAGTAGAAGAGCATTGG + Intergenic
1114429882 14:22651712-22651734 GCCAGGAACATGAAGATAATAGG - Intergenic
1114986574 14:28237552-28237574 ACCATGAAGGTTTAGAGCATAGG + Intergenic
1116095602 14:40363162-40363184 TCCAGGAACATGAAGATAATGGG - Intergenic
1117099144 14:52327945-52327967 ACAATGAAGTTGAAAATCATAGG + Exonic
1117922457 14:60739325-60739347 ACCAAGAGTGTGAATATCATTGG + Intronic
1118010490 14:61605796-61605818 ACCAGGCAGTTGCAGATCAAGGG + Intronic
1118198436 14:63649791-63649813 TCCAGGAACATGAAGATAATGGG - Intergenic
1120245097 14:81996918-81996940 ACCATGTAGATGAAGCTCATTGG - Intergenic
1121692274 14:95886410-95886432 AATAGGAAGGTGAAGTTCAAGGG - Intergenic
1122082289 14:99274301-99274323 CCCAGGAAGGTGAGGGTCGTGGG - Intergenic
1124211486 15:27768442-27768464 TCCAGGCAGGAGAAGATAATAGG - Intronic
1124698906 15:31894151-31894173 ATCAGGAAGGTGAAGAGCCTTGG + Intergenic
1126156411 15:45569535-45569557 ACCAGGAAGGTGAGAATCTTGGG - Intergenic
1126498093 15:49314868-49314890 ACCAGCCATGTGAAGATCTTGGG + Intronic
1126568528 15:50125725-50125747 TCCAGGAACATGAAGATAATAGG - Intronic
1127032495 15:54879643-54879665 ACCAGGAAGGGGGAGATTTTTGG - Intergenic
1127397446 15:58553870-58553892 AGAGGGAAGCTGAAGATCATAGG - Intronic
1128906186 15:71469727-71469749 ACCAGCATGGTGGAGATCATGGG - Intronic
1129681086 15:77658795-77658817 ACCAGCAATGTGAAGATCTGGGG + Intronic
1130836651 15:87656405-87656427 TCCAGGAACATGAAGATAATGGG + Intergenic
1131047760 15:89326898-89326920 ATCAGGAAGGTGGGGAGCATGGG - Exonic
1131522433 15:93126637-93126659 GCCGGGAAGGGGAAGACCATGGG - Intergenic
1134638768 16:15812396-15812418 ACCACGAAGATAAACATCATGGG + Intronic
1136240217 16:28938840-28938862 ACCAGGGAGGAGGAGAACATGGG - Intronic
1140201846 16:72901307-72901329 ACCAGAAAGTTGAAGAGCATGGG - Intronic
1140696300 16:77537613-77537635 ACCAGGAAACTGAAGCTCAGAGG + Intergenic
1144843185 17:18201343-18201365 ACCAGGAAGGTGACAAACTTGGG + Intronic
1145972886 17:28967372-28967394 ACCAGGAACTTGAAGCTCCTGGG + Intronic
1146151764 17:30479045-30479067 AACAAGAAGCTGAAGTTCATAGG + Intronic
1148773109 17:50078232-50078254 ACCAGCAGAGTGAGGATCATGGG - Exonic
1149197391 17:54137422-54137444 ATCATGAAGGTAAAGATCAAAGG + Intergenic
1149225039 17:54460134-54460156 TCCAGGAACATGAAGATAATGGG - Intergenic
1150498188 17:65625375-65625397 ACCAAGAAGGGGAAGGTCTTGGG - Intronic
1154999261 18:21670653-21670675 ACCAGGCAGGTGAAGGTCACAGG - Intronic
1155378248 18:25186278-25186300 ACTACGAAGGTGCAGATAATTGG + Intronic
1155551422 18:26969906-26969928 ACCAAAATGGTGAAGATCAGAGG - Intronic
1156426814 18:37022560-37022582 ACCTGGAAAGTGAAGACCTTTGG + Intronic
1158626815 18:59078687-59078709 AACAGAAAGCTGAAGATCATGGG - Intergenic
1159107416 18:64018944-64018966 ACCAGCTGGGTGAAGATCAAGGG + Intergenic
1161164058 19:2776202-2776224 ACCCGAAAGGTGAAGATTTTTGG + Intronic
1162849265 19:13417983-13418005 GCCAGGAAGGAAAAGAACATGGG - Intronic
1164057623 19:21635100-21635122 ACCAGGAAGCTGAATATCGTGGG - Intergenic
1164540086 19:29115570-29115592 GCCAAGAAGGGGATGATCATAGG + Intergenic
1165023983 19:32945943-32945965 TCCAGGAAGGTGTGGATCTTGGG + Intronic
1166733785 19:45072703-45072725 ACCAGGAAGCTGACGCTCAGAGG + Intronic
925112484 2:1347859-1347881 TCCAGGAACATGAAGATGATGGG - Intronic
926072759 2:9913246-9913268 ACCAGGAAGGAGAACATACTTGG - Exonic
928930400 2:36618153-36618175 TCCAGGAACATGAAGATAATGGG + Intronic
932306998 2:70711131-70711153 ACCAGGATGCTGAAGATCAGAGG + Intronic
932556849 2:72832096-72832118 TCCAGGAATATGAAGATAATGGG + Intergenic
934103827 2:88678391-88678413 TCCAGGAATATGAAGATAATGGG + Intergenic
934989089 2:98908714-98908736 ACCAGAGAGGGGAAGGTCATTGG - Intronic
935708903 2:105880437-105880459 AGAAGAAAGGTGAAGATGATGGG + Intronic
937122733 2:119452008-119452030 ACCAGGATGGAGAGGATCACAGG + Exonic
937343077 2:121104425-121104447 GCCAGGAGGGTAATGATCATGGG - Intergenic
938106531 2:128534913-128534935 TCCAGGAACATGAAGATAATGGG - Intergenic
941130365 2:161640900-161640922 ACCAGTAAGGTGAATTTCATGGG + Intronic
941866166 2:170336968-170336990 ACCATGAAGTTGAAGGTCAGGGG + Intronic
943467182 2:188242140-188242162 ACCGGGAAGTTCAAGATCACAGG - Intergenic
943939174 2:193969015-193969037 AAGAGGAAGGTGAAGATTAGAGG - Intergenic
945881416 2:215328538-215328560 ACCAGGACGGTGAAGGGCAGAGG - Intronic
947051842 2:226053478-226053500 ACCAAAAGGGTGAAGCTCATTGG + Intergenic
947754821 2:232554368-232554390 ACCAGGAAGGAGATGATATTGGG + Intronic
947911584 2:233804184-233804206 ACCTGGAAGGTGAGGTTCCTGGG + Exonic
948916719 2:241038034-241038056 ACCAGGTGGGTGAAGGGCATGGG - Intronic
1168819860 20:765536-765558 CCCAGCAGGGTGAAGATGATGGG + Exonic
1171150675 20:22824160-22824182 ACCAGGAAGGAGAAGAACAAAGG - Intergenic
1171252626 20:23660953-23660975 TCCAGGATGGGGAAGATAATGGG + Intergenic
1171309199 20:24132572-24132594 TCCAGGAACATGAAGATCATGGG - Intergenic
1171505809 20:25632567-25632589 AAGAGCAAGGTGAAGGTCATTGG - Intergenic
1172055141 20:32149700-32149722 AGCAGGGAGCTGAGGATCATGGG - Exonic
1173146656 20:40530500-40530522 GCTTGGCAGGTGAAGATCATGGG - Intergenic
1173438735 20:43056457-43056479 ACAGGGAAGTTTAAGATCATAGG + Intronic
1173451415 20:43167496-43167518 TACTGGGAGGTGAAGATCATTGG - Intronic
1173639635 20:44591679-44591701 ATAAGGAAGCTGAAGCTCATAGG - Intronic
1175634112 20:60566402-60566424 GCCAGGAAGTTGAAGACCAGAGG + Intergenic
1176277267 20:64279571-64279593 AGCAGGAATGTGGAGATCACTGG - Intronic
1177385730 21:20407447-20407469 TCCAGGAACATGAAGATAATGGG + Intergenic
1179022408 21:37652173-37652195 ACCAGGAAGCTTCAGGTCATAGG + Intronic
1181403815 22:22667884-22667906 ACCAGGGGGAGGAAGATCATGGG + Intergenic
1181406138 22:22686320-22686342 ACCAGGGGGAGGAAGATCATGGG + Intergenic
1181414090 22:22746980-22747002 ACCAGGAGGAGGAAGATCATGGG + Intronic
1183482083 22:38070718-38070740 ACCAGGAAGGGAAAGATCAGGGG - Intronic
1184910891 22:47533382-47533404 ACCAGGAAGGGGTGCATCATTGG + Intergenic
949126294 3:448627-448649 ACGAGAAAGGTTAATATCATGGG + Intergenic
949271122 3:2218054-2218076 AACAGGCACGTGAAGATCAAGGG + Intronic
949991711 3:9584676-9584698 TCCAGGAACATGAAGATAATAGG + Intergenic
950472218 3:13193385-13193407 ACTAGGAAGGTAAAGATCAGAGG + Intergenic
950634743 3:14306962-14306984 TCCAGGAACATGAAGATAATAGG - Intergenic
950780198 3:15385201-15385223 TCCAGGAACATGAAGATAATGGG - Intronic
951214827 3:20014132-20014154 ACCATGAAGGAGAAGCTGATGGG - Intergenic
952619135 3:35314828-35314850 TCCAGGAATGTGAAGATAATGGG - Intergenic
955109776 3:55937008-55937030 ACCACGTGGGTTAAGATCATTGG - Intronic
959241986 3:103808389-103808411 ACCAGTAAGGTGAAGTTCACTGG - Intergenic
961029189 3:123587087-123587109 TCCAGGAACATGAAGATAATGGG + Intergenic
961453855 3:127014811-127014833 ACCACGAAGGTGAAGCGCTTGGG - Exonic
961611683 3:128144678-128144700 ACCAGGAAGGGGAAGAGCTCTGG + Intronic
961869593 3:129977686-129977708 CCCAGAAAGGAGAAGATCCTGGG - Exonic
965041391 3:163511757-163511779 ACCTGGAAAGAGAAGGTCATAGG - Intergenic
966251821 3:177874778-177874800 ACCAGGAAGAGGAAGAAAATTGG - Intergenic
966344985 3:178969329-178969351 CCCAGAAAGGGGAGGATCATAGG + Intergenic
969580042 4:8059423-8059445 ACCAGGAAGATGAGGATGACCGG + Intronic
969607770 4:8211108-8211130 ACCAGGAGGGGGAAGAAAATGGG - Intronic
971029184 4:22618802-22618824 ACCAAAACGGTGAAGATCAGAGG - Intergenic
973618437 4:52703615-52703637 TCCAGGAACATGAAGATAATGGG - Intergenic
974894740 4:67925953-67925975 ACCAGGAAAGTAAAAATCTTTGG - Intronic
975177610 4:71306160-71306182 ACCAGGGTGGTTAAGAGCATAGG + Intronic
975677078 4:76837566-76837588 ACCAGAGAGTTGAAGATCTTGGG - Intergenic
977116394 4:93034129-93034151 CCCAGGCAGGTGAACAACATAGG + Intronic
978847894 4:113296114-113296136 ATCAGAAAGGTTAAGAACATGGG - Intronic
982487579 4:155985662-155985684 ACCAGGAAGGAGAAGAGGAATGG + Intergenic
984878654 4:184391263-184391285 TCCAAGGAGGTGAGGATCATGGG - Intronic
986679567 5:10221069-10221091 ACCAGGAAGGGGAGGCTCAGAGG + Intergenic
987274504 5:16347753-16347775 ATCAGCAAGTTGAAGAACATTGG + Intergenic
988445763 5:31284337-31284359 TCCAGGAATGTGAAGTTCCTTGG - Intronic
988658121 5:33234871-33234893 TCCAGGAAGGTCATCATCATAGG - Intergenic
990018630 5:51098380-51098402 ACCAGGAAGCTGCTGATCACCGG + Intergenic
991632521 5:68670674-68670696 ACCAGGAGGGTGATGGTGATGGG + Intergenic
992238303 5:74735618-74735640 TCCAGGCAGGTTAAGTTCATGGG + Intronic
992399196 5:76396203-76396225 TTCAGGAACGTGAAGATAATGGG + Intergenic
993131971 5:83909639-83909661 ACCAGAAAGGAGAAGATGAGGGG + Intergenic
993137597 5:83989671-83989693 ACCAGGCAAGTGGAGATCATGGG - Intronic
993561442 5:89416047-89416069 ACCAGGAATGAGAAGATGAGGGG - Intergenic
994861157 5:105196894-105196916 ACCAGAAAAGTGAAAATCCTGGG - Intergenic
998797335 5:145834358-145834380 TCCAGGAACTTGAAGATAATGGG - Intronic
999370181 5:151050261-151050283 ACAAGAAATGTGAAGATAATTGG - Intronic
1000602578 5:163292689-163292711 ATCAGAAAGGAGAAGATAATAGG - Intergenic
1001060182 5:168481707-168481729 CCCAGGAACGTGAAGATAATAGG - Intergenic
1002457880 5:179356079-179356101 TCCAGGAAGGTCAAGATCCAAGG - Intergenic
1006280310 6:33047375-33047397 AACCTGAAGGTGTAGATCATGGG - Intergenic
1008672592 6:53787366-53787388 AACAGGAAGGTGAAGCTTAGAGG - Intergenic
1009381678 6:63039260-63039282 ACCAGGAAGATGATCATAATAGG - Intergenic
1010120410 6:72369331-72369353 ACCAGAAATGGGAAGTTCATAGG + Intronic
1010344341 6:74794329-74794351 AACATGAAGGAGTAGATCATGGG + Intergenic
1011063906 6:83302832-83302854 GACAGGAAGGTGAAGTGCATGGG + Intronic
1012779023 6:103533653-103533675 TCCAGGAATATGAAGATAATAGG - Intergenic
1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG + Intronic
1014597406 6:123361733-123361755 AATAGGAAGGTGATGGTCATGGG - Intronic
1015918085 6:138238648-138238670 ACCAGGAAGGTGATGAACATGGG - Intronic
1016586124 6:145688367-145688389 AAAAGGAAGGTGAAGATGAAAGG + Intronic
1016636568 6:146299068-146299090 ACAAGCCAGGTGAAGATCAGAGG - Intronic
1018226663 6:161635742-161635764 CCCAGGTAGGTGAAGAGCTTGGG + Intronic
1021091971 7:16494619-16494641 ACCATAAAGGTGAGGATCACAGG + Intronic
1023706300 7:42945316-42945338 TCCAGGAACGTGAAGATAACAGG + Intronic
1025071751 7:55905685-55905707 TCCAGGAACGTGAAGATAATGGG - Intronic
1027578239 7:79958461-79958483 ACCAGGGAGTTGAAGTTGATTGG + Intergenic
1028841813 7:95436626-95436648 TCCAGGAATATGAAGATAATGGG - Intergenic
1033388187 7:140899791-140899813 ACCAGGAGGGTGAGGATCATTGG - Intronic
1033952510 7:146802488-146802510 ACCTGGTAGGAGATGATCATGGG + Intronic
1034228403 7:149500267-149500289 AGCAGGAAGGTGGAGATGGTAGG - Intergenic
1034429271 7:151033084-151033106 CCCAGGGAGGTGAGGATCAAGGG + Intronic
1037667696 8:20984638-20984660 ACCTGTAAGGTGAGAATCATAGG + Intergenic
1037764766 8:21765781-21765803 ACTAGGAAGGAGAAGATGAGAGG - Intronic
1038440974 8:27570603-27570625 CTCAAGAAGATGAAGATCATGGG + Intergenic
1038912418 8:31981203-31981225 TCCAGGAACATGAAGATAATAGG - Intronic
1040644848 8:49386699-49386721 AGCAGGACTGTGAAGATGATAGG + Intergenic
1040704511 8:50109658-50109680 ATCAGGAAGGGGGAGATCCTCGG + Intronic
1041239659 8:55838694-55838716 ATCAGGAAGGTGAAGGTTTTAGG - Intergenic
1042374208 8:68030447-68030469 ACCAGAAAGCTGAAGATCAAAGG + Intronic
1047569615 8:126083633-126083655 ACCTGGGAGGTGAAGGGCATAGG + Intergenic
1049124393 8:140773816-140773838 TCTAGGAATGTGAAGATAATGGG + Intronic
1050840786 9:10146523-10146545 GCCAAGAAGCTAAAGATCATAGG + Intronic
1052300190 9:26945193-26945215 ACCAGGAACTTGAAGAACTTTGG - Intronic
1052673784 9:31593075-31593097 TCCAGGAACTTGAAGATAATGGG - Intergenic
1052868672 9:33482414-33482436 TCCAGGAACATGAAGATAATGGG - Intergenic
1053058265 9:35007293-35007315 AACAGGAAGGTGAAGTTGTTTGG - Intergenic
1055313937 9:75014127-75014149 ACCAGGAGGCTGAAGATTAAAGG + Intronic
1055329560 9:75169810-75169832 TCCAGGAACATGAAGATAATGGG - Intergenic
1055450135 9:76423448-76423470 ACTAGGAAGTTCAAGGTCATGGG - Intronic
1059182902 9:112236413-112236435 ACAAGCAAGCTCAAGATCATAGG + Intronic
1062589491 9:137266971-137266993 ACCAGGAAGGACATGAGCATCGG - Exonic
1186137715 X:6536629-6536651 CCCAGGAAGCTGAAGATAACTGG - Intergenic
1186324412 X:8463289-8463311 CCCAGGAAGCTGAAGATAACTGG + Intergenic
1187891312 X:23937499-23937521 ACCAGGAAGGTGGAGGTTGTGGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189308282 X:40003569-40003591 GCCAGGAAGGGAAAGATCAAAGG - Intergenic
1191223532 X:58016290-58016312 CCCAGGAAGGTAAAGATCTGTGG - Intergenic
1191640584 X:63427127-63427149 AACAGGAAGAGGAAGATCAGGGG + Intergenic
1193588184 X:83353500-83353522 AACTGGAAGGTGAAAATAATTGG + Intergenic
1194624381 X:96211939-96211961 ATCAGGAAGTTGAAGATTCTTGG + Intergenic
1195008432 X:100710805-100710827 ACCAGGTAGCTGGAGTTCATAGG + Intronic
1195868435 X:109458923-109458945 AATATGAAGGTTAAGATCATGGG - Intronic
1197071260 X:122300347-122300369 ACCAGGAAGGTAAAACTCGTCGG - Intergenic
1198125884 X:133643142-133643164 TCCTGGATGGTGTAGATCATGGG + Intronic
1198495254 X:137185827-137185849 ATCAGCAAGGTGGAGGTCATTGG + Intergenic
1200244380 X:154515355-154515377 ACAAGTAAGATGAAGATCCTTGG - Intronic
1201356000 Y:13097568-13097590 CCAAGGAAAGTGTAGATCATAGG - Intergenic
1201439057 Y:13988439-13988461 CCCAGGAAGCTGAAGATAACTGG - Intergenic
1201445516 Y:14054269-14054291 CCCAGGAAGCTGAAGATAACTGG + Intergenic