ID: 1013528261

View in Genome Browser
Species Human (GRCh38)
Location 6:110995414-110995436
Sequence GGCCTGTCCACAACCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013528261_1013528268 17 Left 1013528261 6:110995414-110995436 CCCACTCTGGTTGTGGACAGGCC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1013528268 6:110995454-110995476 CCATTTATGCTTCTGTTTAGAGG 0: 1
1: 0
2: 1
3: 23
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013528261 Original CRISPR GGCCTGTCCACAACCAGAGT GGG (reversed) Intronic
901234128 1:7658464-7658486 GGCCTGGGTACAGCCAGAGTAGG + Intronic
903359366 1:22767168-22767190 GCCCAGTCCAAAACCAGACTAGG + Intronic
907983410 1:59507052-59507074 GGCAGGTCCCCAACCAGAATAGG + Intronic
911973277 1:104463095-104463117 GGCCTCTACCCATCCAGAGTAGG + Intergenic
912755943 1:112325020-112325042 GCTCTGTCCACAACCCCAGTGGG + Intergenic
914974741 1:152351066-152351088 GGATTGTCCATAACCATAGTGGG + Exonic
914974918 1:152352422-152352444 GGACTGTCCATGACCAGAGTGGG + Exonic
914974971 1:152352872-152352894 GGACTGTCCATGACCAGAGTGGG + Exonic
915203464 1:154251484-154251506 GGCATCTCCACAGCCAGAGCAGG - Exonic
922233587 1:223706534-223706556 GGTCTGTCCATACCCAGTGTAGG - Intronic
922727151 1:227927851-227927873 CCCCTGTCCACACCCACAGTTGG - Intronic
1067314457 10:45149013-45149035 GGACTGCCCACAACCAGTCTGGG - Intergenic
1076014422 10:127015943-127015965 GGCCTGTCCTCACCCAGGGGAGG - Intronic
1076809021 10:132877156-132877178 GCCCCGTGCACAGCCAGAGTTGG + Intronic
1077377112 11:2210204-2210226 GTCCTGTCCACATCCAAGGTGGG - Intergenic
1083547658 11:63560963-63560985 GCCCTGGCCACACCCAGAATGGG + Intronic
1087081060 11:94171535-94171557 GTCCTGTTCAGAACCAGACTTGG + Intronic
1090908523 11:131097894-131097916 GGCCTGGTCACAACCAGTGGGGG - Intergenic
1098868004 12:75784216-75784238 GGCCTTCTCACAACCTGAGTAGG + Intergenic
1101212356 12:102547057-102547079 GGCCTGTGGACAACCAGAGGAGG - Intergenic
1101328488 12:103737873-103737895 GGCCTGTCCTCAGCAAGACTAGG + Intronic
1101745781 12:107540383-107540405 GACCTGTCCTCACCCAGTGTGGG - Intronic
1104809948 12:131614067-131614089 GTCATGTCCAGAGCCAGAGTAGG - Intergenic
1114635807 14:24186169-24186191 AGCATGTCCACAACCTGAGATGG + Exonic
1117784151 14:59265259-59265281 GGCCTATTGCCAACCAGAGTTGG + Intronic
1118867969 14:69718183-69718205 GGCCTTCCCACTACCAGAGTGGG - Intergenic
1122342790 14:101039206-101039228 GGCCTCTTCACATCCAGAGATGG - Intergenic
1127304085 15:57684940-57684962 GGCCTGTCCACAAGAAGCATGGG + Exonic
1132518498 16:376897-376919 TGCCTGGCCCCCACCAGAGTGGG - Intronic
1132770992 16:1563187-1563209 GGCATCTCCACCACCAGAGCAGG - Intronic
1135718137 16:24790798-24790820 AGTCTGTCCCCAACCAGAGTTGG - Exonic
1136448664 16:30339814-30339836 GGCCTGGACCCACCCAGAGTGGG - Intergenic
1142047197 16:87933049-87933071 GGCCTGCACCCACCCAGAGTGGG + Intronic
1142089098 16:88200532-88200554 GGCCGGTCTGCAACCAGAGAAGG + Intergenic
1143021602 17:3919572-3919594 GGCCAGGTCACACCCAGAGTTGG - Intergenic
1143104113 17:4519900-4519922 GGCCTGAACACAATCAGGGTAGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1143771295 17:9170656-9170678 GGGCTGTGCACATCCAGATTTGG + Intronic
1147260788 17:39208900-39208922 GGTCCGTCCACCCCCAGAGTGGG + Intergenic
1149066155 17:52481714-52481736 GGCAAGTCCATAACCAGAGAGGG - Intergenic
1151668105 17:75557237-75557259 GCCCTATCCACAAGCAGAGATGG + Intronic
1152469348 17:80482236-80482258 GCCCTGTCCCCAGCCAGACTGGG - Intergenic
1152769221 17:82157244-82157266 GGCCTGACCAAAACCAGGATAGG + Intronic
1159206953 18:65265352-65265374 GGCAAGTCCATAACCAGAGTAGG + Intergenic
1159851037 18:73527479-73527501 AGCCTTTCCACAATCAGTGTGGG - Intergenic
1160667214 19:336571-336593 GGCCAGTCCACAGACAGAATGGG + Intronic
927731787 2:25479986-25480008 GGTCTGTCCACATTCAGAGGAGG + Intronic
930718685 2:54618058-54618080 GGCCTGTGCAGAACAACAGTGGG - Exonic
931723052 2:65081311-65081333 GTGCTGTCCACAAAGAGAGTTGG - Intronic
932621210 2:73265754-73265776 TGCCTTTCCACACCCAGAGGGGG - Intronic
934578086 2:95415681-95415703 AGCCCTTCCACAACCAGAGCTGG - Exonic
934601353 2:95661023-95661045 AGCCCTTCCACAACCAGAGTTGG + Intergenic
936347899 2:111689057-111689079 GGCCTGTCCTCAGCCAGGCTGGG - Intergenic
937647616 2:124283506-124283528 AGCCTCTCTGCAACCAGAGTTGG - Intronic
937670777 2:124535211-124535233 CTCCTGTGCACAACCAGAGCTGG - Intronic
940991030 2:160096751-160096773 GGCAGTTCCTCAACCAGAGTAGG - Intergenic
941826664 2:169906116-169906138 GGCCTGTGCACAGCCAATGTGGG + Exonic
1172877441 20:38174010-38174032 GACCTGTCCTTAACTAGAGTTGG - Intergenic
1175182281 20:57157114-57157136 GCCATGTCCTCAGCCAGAGTGGG - Intergenic
1178397845 21:32258474-32258496 AGCCTGTTCACAACCACAGTGGG - Intergenic
1179237317 21:39559415-39559437 TACCTGTCCATACCCAGAGTAGG - Intronic
1183475248 22:38032619-38032641 GCCCTGTCCACACCCTGATTGGG + Intronic
1185004528 22:48267954-48267976 GGCCTGTCCATTGCCAGGGTGGG + Intergenic
952953941 3:38545108-38545130 GGCATGACCCCACCCAGAGTAGG + Intergenic
953508627 3:43512016-43512038 GGGCTGTCCAAAAGCACAGTGGG - Intronic
954810011 3:53241809-53241831 TGCCTGTCAACACCCAGACTGGG + Intronic
960096914 3:113697621-113697643 AGCCCTTCCACAACCAGATTTGG + Intergenic
960697698 3:120412088-120412110 GGACTCTCCACCACCAGAGATGG + Intronic
961033340 3:123625213-123625235 GACCTGGTCGCAACCAGAGTTGG - Intronic
964307198 3:155354771-155354793 GGCATGTTCAGAACCAGAGGAGG - Intergenic
965622604 3:170656018-170656040 GGCCTGTGCACATCCTGAGATGG - Intronic
969517661 4:7656598-7656620 GCCCTGGCCACAGCCAGAGGTGG - Intronic
978798555 4:112732524-112732546 GGCCTGTGCCCAGCCAGAGTAGG + Intergenic
980861814 4:138508127-138508149 GGACTGTGCACACCCACAGTAGG + Intergenic
986700400 5:10402080-10402102 GGCCTAATCACAACCATAGTTGG + Exonic
994122612 5:96133877-96133899 GGCCTCTCCAAAAACACAGTGGG - Intergenic
997205123 5:132043700-132043722 GGGCTCTCCAAAGCCAGAGTTGG + Intergenic
997475412 5:134139639-134139661 GGCCTGTCCTCAGCTGGAGTTGG + Intronic
1006389213 6:33748773-33748795 GGCCTCCCCACACCCAGAGAGGG + Intergenic
1010932142 6:81816172-81816194 GCCCTCTCCACAAATAGAGTTGG - Intergenic
1013528261 6:110995414-110995436 GGCCTGTCCACAACCAGAGTGGG - Intronic
1018108417 6:160511369-160511391 TCCCTGTCCACAACCAGTGACGG + Intergenic
1018709190 6:166485743-166485765 GGCCAGACCACACCCAGATTTGG + Intronic
1018915298 6:168129164-168129186 GGCCTGTCCACGAGGAGAGCGGG + Intergenic
1020097343 7:5376430-5376452 GCCCTGTCCACACCCGGGGTGGG + Intronic
1022065867 7:26857376-26857398 TGACTGTCCACAACCAAACTTGG + Intronic
1024798199 7:53044434-53044456 GACCTGTTCACAAGCAGACTCGG + Intergenic
1027129291 7:75579798-75579820 TGCCTGTCCACATGCAGAGAAGG + Intronic
1028442325 7:90878295-90878317 GGCCTGACCTCAATCAGAATGGG - Intronic
1032117083 7:129126578-129126600 GGCCCGTCCCCAACCAGCGAGGG + Intergenic
1034666434 7:152821861-152821883 GGCCTGTTCACAACCACAGAAGG - Intronic
1035224001 7:157423781-157423803 GCTCTGTCCACAGCCAGTGTGGG - Intergenic
1036502226 8:9324660-9324682 GGCCTGTCCAATCCCAGATTGGG + Intergenic
1036748736 8:11429654-11429676 GGCCTGTCAGCACCCAGAGCTGG + Intronic
1037948334 8:23003328-23003350 GGCTTGTCCACCCCCAGAGAGGG - Intronic
1042779584 8:72475983-72476005 GGGCAGTCCACAACAAGGGTTGG - Intergenic
1044259218 8:90098305-90098327 GGCCAGTCCGTCACCAGAGTGGG - Intergenic
1049749774 8:144277624-144277646 GGCCTGTCCACATCCAGCACAGG - Intronic
1050516953 9:6454703-6454725 GGCCTGCTCAAAACCAAAGTGGG - Intronic
1058357211 9:104096618-104096640 GACCTGTCCAAAAACAGAATGGG - Intronic
1060293336 9:122324655-122324677 GGCCTTGCCACCACCAAAGTGGG - Intergenic
1061589347 9:131588692-131588714 GGCCTGTGCAGAACCAGGATGGG + Intronic
1062308610 9:135923552-135923574 GGCCTGTCCAGAGCCCCAGTCGG + Intergenic
1062384494 9:136303805-136303827 GGCGTGCCCACGACCAGGGTCGG + Exonic
1186057424 X:5664856-5664878 GGGCTGTCCACATGCACAGTCGG + Intergenic
1189329799 X:40137022-40137044 GGGCTGTCCTCAACCATAGGAGG + Intronic
1197140735 X:123114894-123114916 GGCCTTGCCACCACCAAAGTGGG + Intergenic
1197154972 X:123260282-123260304 GGCCTATCCTGAACCAGAATAGG - Intronic