ID: 1013530080

View in Genome Browser
Species Human (GRCh38)
Location 6:111011116-111011138
Sequence CCACAGGCAAGATGGACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013530080_1013530086 16 Left 1013530080 6:111011116-111011138 CCTACTGTCCATCTTGCCTGTGG 0: 1
1: 0
2: 0
3: 24
4: 215
Right 1013530086 6:111011155-111011177 ATCCCTTCTAGAATCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013530080 Original CRISPR CCACAGGCAAGATGGACAGT AGG (reversed) Intronic
901427324 1:9190730-9190752 CCACATGGAAGATGGACTTTGGG - Intergenic
901955544 1:12782600-12782622 CCACTGCCAGGAGGGACAGTAGG - Intergenic
901978916 1:13018651-13018673 CCACTGCCAGGAGGGACAGTAGG - Intronic
902003165 1:13210287-13210309 CCACTGCCAGGAGGGACAGTAGG + Intergenic
902022391 1:13356037-13356059 CCACTGCCAGGAGGGACAGTAGG + Intergenic
902692987 1:18121860-18121882 TCAAAGGCAATTTGGACAGTCGG - Intronic
902803529 1:18846400-18846422 CCACAGGGAACAGGGAAAGTTGG - Intronic
903319684 1:22535209-22535231 TCTCAGGCAGGATGGACAGAGGG - Intergenic
903911384 1:26728700-26728722 ACACACACAAGATGGAGAGTAGG - Intronic
904517085 1:31065101-31065123 CCACAGGCGAGATTCACCGTGGG - Intronic
905271650 1:36791401-36791423 ACTCATGCAAGATGGCCAGTGGG + Intergenic
906253082 1:44326326-44326348 CCACAGGGAAGAGGGTAAGTTGG + Intronic
906484818 1:46226153-46226175 ACACAGGCAGGGTGGAAAGTGGG + Intergenic
906960686 1:50417775-50417797 CCGCAGGCAAGAGGGGCAGGTGG + Exonic
907590092 1:55658258-55658280 CCACAGGAAATGTGCACAGTGGG - Intergenic
908834744 1:68217738-68217760 CCACAGTTAAGCTGAACAGTTGG - Intronic
910218643 1:84866963-84866985 CCACAGGCAAGACTGAGATTTGG + Intronic
912184939 1:107264112-107264134 CTACAGGCAAGAAGGAAAGATGG - Intronic
913554113 1:119947972-119947994 CCACAGGCAAGAAAGAGAGAAGG + Intronic
916078494 1:161217601-161217623 CCTCAGCCAAGATGGGTAGTGGG - Intronic
917293743 1:173497046-173497068 ACGCAGGCAAGTTGTACAGTAGG - Intergenic
921570589 1:216773751-216773773 CAACAGATAAGATGAACAGTGGG + Intronic
922165138 1:223109001-223109023 CCAGAGGAAAGAGGTACAGTGGG + Intergenic
922388125 1:225108726-225108748 CCACAGGAAAAATGGACAAATGG - Intronic
923251883 1:232185483-232185505 CAACAGGGAAGATGCACAGGTGG - Intergenic
923729845 1:236539630-236539652 CCACAGGCCAGAGGGCCAGCAGG - Intronic
1063335359 10:5207424-5207446 CCATATGCAAGATGCACAGATGG + Intronic
1063523265 10:6760011-6760033 CCAGAGGAAACATGGCCAGTGGG + Intergenic
1065861851 10:29878487-29878509 CCACAGGCAAGAAGGACAAGAGG + Intergenic
1067159987 10:43817827-43817849 CCTCAGGCAAGAGAGTCAGTGGG - Intergenic
1067810949 10:49426675-49426697 CCACAGGCAAGAGCCAAAGTTGG + Intergenic
1069493767 10:68884512-68884534 ACACTGGCAAGACTGACAGTGGG - Exonic
1069716744 10:70526019-70526041 GCAGTGGCACGATGGACAGTCGG + Exonic
1069855501 10:71438832-71438854 CCCCAGGCCAGATGCACAGTAGG + Intronic
1070391551 10:75975250-75975272 ACTCAGGCAAGTTGGGCAGTAGG - Intronic
1072422771 10:95303478-95303500 TCACCAGCAAGATGGCCAGTGGG + Intergenic
1074039616 10:109775338-109775360 CCACAGACAAGATGGGCAAATGG + Intergenic
1074202579 10:111251981-111252003 CCAAAGGCAAAATGGACAAAGGG + Intergenic
1074496650 10:113985438-113985460 CCCCAGCCAAGATGAACACTGGG + Intergenic
1075256071 10:120926792-120926814 CTGCAGGCAGTATGGACAGTGGG + Intergenic
1077555422 11:3223759-3223781 CCCCAGGTCAGATGGAGAGTGGG + Intergenic
1077840891 11:5973643-5973665 CCACAGAGAAGACGAACAGTTGG + Intergenic
1079732217 11:23948504-23948526 CTACAGGACAGATGAACAGTTGG - Intergenic
1080128992 11:28770832-28770854 CAACAGGCAATATTGCCAGTAGG - Intergenic
1081017829 11:37905987-37906009 CCATCTGCAAGATGGACAGGAGG - Intergenic
1084775615 11:71372744-71372766 ACACTGGCAAGAAGGACAATGGG + Intergenic
1085031311 11:73272565-73272587 TCACAGGCAAGAGTGGCAGTAGG + Intronic
1085922486 11:80974554-80974576 CCTCAGACAATATGGACATTTGG - Intergenic
1088475040 11:110227322-110227344 CCACTAGGAAGATGGACATTTGG + Intronic
1088512048 11:110587208-110587230 CCAAAAGCAAGAGAGACAGTTGG - Intronic
1088549740 11:111000459-111000481 CCACAGGCAAAATGAAAGGTAGG + Intergenic
1089868864 11:121655240-121655262 TCGCAGGCAAGAGGGACGGTGGG + Intergenic
1089901627 11:121992593-121992615 CCCAAGGACAGATGGACAGTTGG - Intergenic
1090991415 11:131820211-131820233 AGACAGGGAAGATGGAGAGTGGG - Intronic
1091357936 11:134952325-134952347 CCACAGGAAAGGAGGTCAGTGGG - Intergenic
1092571266 12:9724499-9724521 CCTCAGCAAAGAAGGACAGTAGG + Intronic
1093141692 12:15516972-15516994 CCATAGGAAAGACTGACAGTTGG - Intronic
1094180122 12:27583710-27583732 CCACAGGCCAGAAGGACTGTGGG - Intronic
1094431446 12:30374266-30374288 ACAAAGACAAGATGGACAGAAGG + Intergenic
1095860101 12:46907376-46907398 CCAGAGGAAATTTGGACAGTTGG + Intergenic
1096512436 12:52138486-52138508 CAACAGACAAGATAGAAAGTGGG - Intergenic
1098490020 12:71064693-71064715 CAACAGACATGATAGACAGTGGG + Intronic
1100382349 12:94073573-94073595 CCACAAGCCAGATGGGCAGTGGG + Intergenic
1101513655 12:105414938-105414960 CCACAGGCAAGAAGGACTGAGGG + Intergenic
1102148389 12:110671583-110671605 CCACAGGCAACCAGGACAGAGGG + Intronic
1106079135 13:26486047-26486069 CCCGAGGCAAGGTGGACAGTCGG + Intergenic
1109469870 13:62790883-62790905 ACAAAGACAAGATGGACAGAAGG + Intergenic
1111194930 13:84862103-84862125 CCACATTCAAGAAGGGCAGTAGG - Intergenic
1111627242 13:90804723-90804745 CCACAGGGAAGAAAGACAATTGG + Intergenic
1111916836 13:94369640-94369662 ACACAGGTAAGATGGACACCTGG - Intronic
1113595412 13:111528382-111528404 CCAGAGGCTAGGTGGACAGCAGG - Intergenic
1113595431 13:111528511-111528533 CCAGAGGCCAGGTGGACAGCGGG - Intergenic
1113595462 13:111528689-111528711 CCAGAGGCCAGGTGGACAGCAGG - Intergenic
1113595482 13:111528777-111528799 CCAGAGGCCAGGTGGACAGCAGG - Intergenic
1117212228 14:53512605-53512627 CCACAGGCAAGAATGAAAGTAGG + Intergenic
1117242424 14:53848138-53848160 CCACAGGCATTTTGGAGAGTGGG - Intergenic
1119706478 14:76785880-76785902 CCCCAGCCAGGCTGGACAGTTGG - Intergenic
1119709391 14:76810770-76810792 CAACAGGCAAGAAAGAAAGTGGG + Intronic
1120252156 14:82070930-82070952 CCAAAGGGAAGGTGGACAATAGG - Intergenic
1122249728 14:100429451-100429473 CCTCAGGGCAGATGAACAGTGGG - Intronic
1123694291 15:22865921-22865943 CACCAGGCAAGAGGGACAGTGGG - Intronic
1124031756 15:26018414-26018436 CCACAGGCAAGAAGTAAAGTGGG - Intergenic
1124126517 15:26942346-26942368 CCACAGGCACCATGCACAGCAGG + Intronic
1124169656 15:27361099-27361121 CCACAGCCATGATGGACCGCAGG - Intronic
1124371978 15:29109195-29109217 CCACAGTCAGGAAAGACAGTGGG + Intronic
1127426077 15:58858875-58858897 CCCAAGGCAAGATAGAAAGTCGG - Exonic
1127974123 15:63984606-63984628 CCCCGGGCAAGATGGTCACTGGG - Intronic
1127981839 15:64041179-64041201 CCAAAGGAAAGATGGACAGGAGG + Intronic
1129105709 15:73305814-73305836 CCACAGAGCAGATGAACAGTGGG - Intergenic
1129180238 15:73869650-73869672 CCACAGGCAAGAGGGAGACTTGG + Intergenic
1129360110 15:75019321-75019343 CCAGAGGCAAGAGGGGCAGGTGG - Exonic
1129366184 15:75056589-75056611 CCACTGGCCACAAGGACAGTGGG - Intronic
1130363263 15:83209475-83209497 CCACAGGGAGGCTGGACTGTAGG - Intergenic
1130564905 15:84985682-84985704 CCCCAGGCCTGATGCACAGTAGG + Intronic
1132653318 16:1031204-1031226 CCTTAGGCCAGATGGACAGTGGG + Intergenic
1133279324 16:4656096-4656118 CCACAGGCAAGCAGGGCGGTGGG + Intronic
1134623638 16:15708580-15708602 CCAGAGGCAGGAAGGACAGTGGG + Intronic
1137811089 16:51353148-51353170 CCACAAGCAAGAAGGGCAATGGG - Intergenic
1137881372 16:52051992-52052014 TCACAAGCACAATGGACAGTTGG + Intronic
1137925189 16:52533880-52533902 CAACAGGCAGGAAGGACTGTTGG + Intronic
1138272071 16:55702516-55702538 CCCCAGGCCAGATGCACAGAAGG - Intronic
1138468001 16:57207827-57207849 CCACAGACAAAATGGGCAGGTGG - Intronic
1138493472 16:57392252-57392274 CCACAGACACCATAGACAGTGGG - Intergenic
1139495220 16:67311873-67311895 CCACAGACAAGCTACACAGTTGG + Intronic
1139559275 16:67731289-67731311 GCACTGCCCAGATGGACAGTTGG - Intronic
1141151865 16:81570022-81570044 GCACAGGCCTGGTGGACAGTTGG - Intronic
1141704984 16:85659883-85659905 CCACAGGCCACTTGGGCAGTGGG + Intronic
1143141604 17:4744544-4744566 CACCAGGCAAGATGGGGAGTGGG - Intronic
1148957470 17:51365610-51365632 CCATCTGCAAGATGGACAGAGGG - Intergenic
1151407234 17:73896513-73896535 CCAGAGGCAAGCTGGACTGCTGG + Intergenic
1152234564 17:79132022-79132044 CCCCAGGCAAGACGCAGAGTAGG - Intronic
1152364597 17:79848130-79848152 ACACAGGCCAGATGGACATCCGG - Intergenic
1153966845 18:10190137-10190159 CTACAGGCCAGGTGGACACTGGG + Intergenic
1155057781 18:22200369-22200391 CCACTGGCAAGATGCAAAGCTGG - Intronic
1162289806 19:9770302-9770324 CTACAGGCAATATCTACAGTAGG - Intronic
1162582233 19:11538571-11538593 CCAGAGGCCCAATGGACAGTGGG + Intergenic
1162959045 19:14115559-14115581 CCACAGGCTAAATGGCCAGGCGG - Intronic
1164674095 19:30090498-30090520 CCACGGGGCAGATGGGCAGTGGG + Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1168721302 19:58556256-58556278 CAACAGGCCAGAGGGACAGAAGG + Intronic
925228886 2:2212898-2212920 CCTCAGAGAAGATGGACACTGGG - Intronic
928672102 2:33612273-33612295 ACAAAGACAAGATGGACAGAAGG - Intergenic
930762951 2:55055802-55055824 CCAGAGCCTAGATGGTCAGTAGG - Intronic
931593680 2:63915584-63915606 CCAAAAGCAAGATGGCCAGAGGG + Intronic
932034340 2:68226224-68226246 CCACAGTCAAGATGTAGAATAGG - Intronic
932183807 2:69674006-69674028 CCGCAGGTAAGAAGCACAGTGGG - Intronic
932836397 2:75042110-75042132 CCAGAGGGAAGAGAGACAGTGGG - Intergenic
934768034 2:96891574-96891596 CCACAGTCTAGCTGGACAGGGGG + Intronic
935123709 2:100203799-100203821 GCAGAGGCAAGACGGACAGTTGG - Intergenic
935880682 2:107561964-107561986 ATGCAGGCAACATGGACAGTTGG - Intergenic
937028695 2:118720374-118720396 CCACAGGCACGCTGCACAGATGG + Intergenic
937234256 2:120420898-120420920 CCAAAGGCAAGAAGGACAAGAGG + Intergenic
940985244 2:160045888-160045910 CCAGAGGCCACATGGACAGGCGG + Intronic
941254247 2:163208150-163208172 CCACAGGCCACATGGAAACTTGG + Intergenic
941877943 2:170454083-170454105 ACAAAGACAAGATGGACAGAAGG + Intronic
945236802 2:207638755-207638777 CCACATGCAAGATGGTTGGTGGG + Intergenic
946179540 2:217941367-217941389 CCACAGGCAAGGGGCAGAGTGGG + Intronic
946504297 2:220282482-220282504 CCAATGGCAAGAGGGAAAGTTGG + Intergenic
947104596 2:226655401-226655423 CCATAGGGAAGATGGTCAGAAGG - Intergenic
948575973 2:238949960-238949982 ACACAGGCCAGAAGGACAGTTGG - Intergenic
1168945954 20:1757859-1757881 CCAGAGGCTAGTTTGACAGTTGG - Intergenic
1170780269 20:19419563-19419585 CCACATGACAGATGGACAGCTGG - Intronic
1172123560 20:32612358-32612380 TCTCAGGCAAGCTGGACAGCTGG + Intergenic
1172126091 20:32626198-32626220 CCACAGGCATGCTGGGAAGTGGG - Intergenic
1172590628 20:36115308-36115330 GCAAAGGCAAGATGGCCACTTGG - Intronic
1172768680 20:37364433-37364455 CCACAAGGAGGAGGGACAGTTGG - Intronic
1173154576 20:40596794-40596816 ACCCAGGCAGGATGGGCAGTGGG - Intergenic
1173857925 20:46262806-46262828 GCAGTGGCAAGATGGAGAGTAGG - Intronic
1177113947 21:17063153-17063175 TCAGTGGCAAGATGTACAGTGGG + Intergenic
1180065574 21:45410471-45410493 CCACAGGGAGGAAGGCCAGTGGG + Intronic
1180971869 22:19820128-19820150 GCCCAGGCAGGATGGGCAGTGGG + Intronic
1182898114 22:33875403-33875425 CCCCAGTCAAGAGGGACAGGTGG - Intronic
1183369204 22:37423027-37423049 CCACAAGCAAGATGGCCAGGTGG + Intronic
1183667839 22:39255454-39255476 CCAGAGGCAAAAAGGACAATCGG + Intergenic
1184592406 22:45493937-45493959 CCACAGGAAGGGTGGACAGTAGG - Intergenic
950118781 3:10468166-10468188 CCACAGCCCACATGGACACTGGG - Intronic
951253295 3:20419082-20419104 CTTGAGGCAAGATGGACAGCTGG + Intergenic
953449700 3:42995958-42995980 CCACAGGCCAGATGGAATTTTGG - Intronic
953628092 3:44587454-44587476 CCACAGGCCAGTAGGACACTAGG - Intronic
954433702 3:50484865-50484887 CCACACACAAGCTGGACAGGAGG - Intronic
955028380 3:55192085-55192107 ACACAGGCAACAGGGACAGAAGG + Intergenic
956613396 3:71146966-71146988 TCAAAGGCAAGCTGGACAGGTGG - Intronic
957286613 3:78224315-78224337 CCACAGGAAAGAAAGACATTAGG - Intergenic
959906802 3:111719480-111719502 ACACTGGCAGGATGGACACTTGG - Intronic
960139319 3:114137230-114137252 CCACAGGAAAAATGGTAAGTGGG - Intronic
960971157 3:123141214-123141236 CCATGGTCAAGATGGACAGTGGG - Intronic
961449092 3:126994453-126994475 CCACAGGCCACATGGGCAGAGGG + Intronic
961818758 3:129564590-129564612 CCATAGGGCAGCTGGACAGTGGG + Intronic
962866599 3:139452481-139452503 GCACAGGGCTGATGGACAGTGGG + Intergenic
966295795 3:178421221-178421243 ACACAGGGAAGATGGAAAGAGGG + Intronic
966888949 3:184392429-184392451 CCACAGGGCAGAGGGACAGATGG + Intronic
967255828 3:187591075-187591097 CCACAGAAAAGATAGAGAGTCGG - Intergenic
967962226 3:194934966-194934988 CCACAGGCAAGGTGAACCCTGGG - Intergenic
968894680 4:3392210-3392232 CCCCAGGCTAGATAGACTGTGGG + Intronic
969350435 4:6595141-6595163 ACACAGGCATGATGCACAGGAGG - Intronic
969643317 4:8412104-8412126 CCACAGGCAAAGAGGACAGCAGG + Intronic
971739297 4:30500154-30500176 CAACAAGCAAGATTGACAGATGG + Intergenic
974258170 4:59488926-59488948 CTACAGGCAAGAAGAAAAGTGGG + Intergenic
975562669 4:75722214-75722236 GCACAGGAGTGATGGACAGTTGG - Intronic
981538586 4:145825195-145825217 CCATGGGCGGGATGGACAGTAGG + Intronic
981578280 4:146227443-146227465 ACACAGGCAACATGCACAGAGGG - Intronic
990800208 5:59593645-59593667 CCACTGGTGAGATAGACAGTAGG + Intronic
994289742 5:98014673-98014695 CCACAGGCATGGGGGACAGCAGG - Intergenic
997298686 5:132786179-132786201 CCACAGGCAAGATGGTATGGTGG + Intronic
997619517 5:135276485-135276507 CCACAGGCCAGCTGCACAGGCGG - Intronic
997856243 5:137375365-137375387 AAACAGGCAAAATGAACAGTTGG + Intronic
998044178 5:138972896-138972918 CCTCAGGCAAGGGGGACAGAGGG + Intronic
998159287 5:139803964-139803986 CCACTGGCAGCATGGGCAGTAGG - Intronic
998810886 5:145964721-145964743 CCACAGTCAAAATGGACACAGGG - Intronic
1001285901 5:170423804-170423826 CCACAGGCCAGATGGGGAGCCGG + Intronic
1001589464 5:172855521-172855543 AAACAGGGAAGATGGACAGTTGG + Intronic
1002534438 5:179868557-179868579 CCACTGGCCAGATGGTCACTGGG - Intronic
1004099586 6:12595170-12595192 CCACAGGCAAGATGAAGAGCTGG - Intergenic
1004279063 6:14265087-14265109 CCTCAGGGAAGAAGGGCAGTGGG + Intergenic
1004296033 6:14411891-14411913 CCTCAAGCAAGATGTAGAGTTGG + Intergenic
1004519116 6:16345727-16345749 TCACTAGCAAGATGGACAATGGG + Intronic
1004545742 6:16596776-16596798 CCAAAGGCAAGATGGGTAGAAGG + Intronic
1008810416 6:55490726-55490748 CCACAGGTAATATGGATAGTTGG - Intronic
1009760342 6:67996940-67996962 GCACAGGCAAGCTACACAGTGGG + Intergenic
1013530080 6:111011116-111011138 CCACAGGCAAGATGGACAGTAGG - Intronic
1017140480 6:151185152-151185174 CCAGATGACAGATGGACAGTAGG - Intergenic
1017568497 6:155714796-155714818 ACACAGGAAAGCTGGACATTAGG - Intergenic
1019183174 6:170205377-170205399 CCCAAGGCAAGGTGGGCAGTGGG - Intergenic
1024169486 7:46769170-46769192 ACAAAGACAAGATGGACAGAAGG - Intergenic
1026349471 7:69503170-69503192 CCACAGGAAAGATGGATAAAAGG + Intergenic
1027943435 7:84714894-84714916 CCACACTGAAGATGCACAGTAGG - Intergenic
1028260016 7:88652290-88652312 CCAAAGGAAAAATGGACAGTTGG + Intergenic
1032086342 7:128885820-128885842 GCAGAGTCAAGATGGACACTTGG - Intronic
1033023922 7:137754414-137754436 GCACAGGGAAGAAGGGCAGTGGG + Intronic
1035164904 7:156981263-156981285 CCACAGGCAAGTTGTTCTGTGGG + Intergenic
1035702137 8:1644209-1644231 CTGCAGGCAGGATGGAGAGTGGG - Intronic
1035971308 8:4252255-4252277 TCACAGGAAAGATGGGCAGAAGG - Intronic
1036154698 8:6330337-6330359 CAACAGGAAAGAAGGAGAGTGGG + Intergenic
1037731392 8:21526599-21526621 CCACAGGCAAGCTGGGCCCTGGG + Intergenic
1038319308 8:26513533-26513555 GCACAGGCAGGGTGGACAGGAGG - Intronic
1039896833 8:41722806-41722828 CCACAGGCAATATGCAAACTAGG - Intronic
1043706559 8:83358096-83358118 ACAAAGACAAGATGGACAGAAGG + Intergenic
1047027538 8:120840455-120840477 CCACAGACAAGAAGGACAAGGGG - Intergenic
1047290541 8:123525757-123525779 GCACAGTCAAGCTGTACAGTAGG - Intronic
1056655128 9:88502832-88502854 TCACAAGCAAGATGGACAGGAGG + Intergenic
1056946312 9:91000398-91000420 CAAAAGGCCAGAAGGACAGTGGG - Intergenic
1057274097 9:93667144-93667166 CCAGAGTCAAGAAGGAGAGTGGG + Exonic
1057421061 9:94912832-94912854 ACACAGGAAGGATGGAGAGTGGG + Intronic
1057618969 9:96618954-96618976 CCACCAGCAAGATGGACCGAGGG - Intronic
1057973193 9:99576849-99576871 CCAAAGGCAAGGAGGCCAGTTGG + Intergenic
1058020761 9:100085222-100085244 CCATTGGAAAGATGGAGAGTTGG - Intronic
1060246876 9:121953887-121953909 CCTCAGGCAAGTTGTACAGGTGG - Intronic
1060739431 9:126088554-126088576 CCACAGGGTAGATGCTCAGTAGG + Intergenic
1061730608 9:132611076-132611098 GAACAGGCAAGCTGGACACTGGG + Intronic
1062311252 9:135938689-135938711 CCACAGGCAAGCTGGGCACTTGG - Intronic
1062588819 9:137263801-137263823 CCACAGGCCAGGTGGAAAGATGG - Intronic
1185482980 X:461240-461262 ACACACGCAAGATGCAGAGTGGG + Intergenic
1187450099 X:19388364-19388386 CCCCAGGCAGGATGAAAAGTGGG + Intronic
1189197028 X:39161594-39161616 CCACTGGCAGGCTGGACAGGCGG - Intergenic
1191853487 X:65603836-65603858 TCACAGTCAAGAGGGACAGAAGG + Intronic
1194979404 X:100424924-100424946 CCACAGGCAAAATTGACATAAGG + Intergenic
1199745524 X:150769908-150769930 CCACAGGCAAGAGGGAACTTGGG - Intronic
1201764182 Y:17563936-17563958 CCAGAGGCAAGAAGGACTTTAGG - Intergenic
1201837371 Y:18342054-18342076 CCAGAGGCAAGAAGGACTTTAGG + Intergenic
1202067883 Y:20959886-20959908 ATACAGGCAGGAAGGACAGTAGG + Intergenic