ID: 1013530694

View in Genome Browser
Species Human (GRCh38)
Location 6:111017210-111017232
Sequence CGGGGTGGCGGCCGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4204
Summary {0: 2, 1: 205, 2: 1212, 3: 1143, 4: 1642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013530680_1013530694 13 Left 1013530680 6:111017174-111017196 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1013530694 6:111017210-111017232 CGGGGTGGCGGCCGGGTAGAGGG 0: 2
1: 205
2: 1212
3: 1143
4: 1642
1013530682_1013530694 12 Left 1013530682 6:111017175-111017197 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1013530694 6:111017210-111017232 CGGGGTGGCGGCCGGGTAGAGGG 0: 2
1: 205
2: 1212
3: 1143
4: 1642
1013530678_1013530694 28 Left 1013530678 6:111017159-111017181 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1013530694 6:111017210-111017232 CGGGGTGGCGGCCGGGTAGAGGG 0: 2
1: 205
2: 1212
3: 1143
4: 1642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013530694 Original CRISPR CGGGGTGGCGGCCGGGTAGA GGG Intronic
Too many off-targets to display for this crispr