ID: 1013530951

View in Genome Browser
Species Human (GRCh38)
Location 6:111018185-111018207
Sequence CATCAGGGGGAGACCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 2, 2: 90, 3: 28, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013530943_1013530951 -8 Left 1013530943 6:111018170-111018192 CCAGCTTCGGCTCGGCATCAGGG 0: 4
1: 455
2: 574
3: 447
4: 269
Right 1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG 0: 1
1: 2
2: 90
3: 28
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013530951 Original CRISPR CATCAGGGGGAGACCGGGGA GGG Intronic
900098024 1:948260-948282 CATCAGGGAGAGGCTGGGGCTGG + Intronic
900545965 1:3229363-3229385 CACCTAGGGGAGGCCGGGGAGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903134025 1:21297429-21297451 GGTCAGGGGGTCACCGGGGAAGG - Intronic
903278344 1:22235964-22235986 AATGAGGGGCAGACCTGGGAAGG + Intergenic
903652337 1:24929801-24929823 CCGCAGGGGAAGGCCGGGGAGGG + Exonic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904471687 1:30740289-30740311 CACCAGGGCTAGATCGGGGAAGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907362399 1:53929161-53929183 CACCAGGGGGAGACTGGGGTGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910666162 1:89727827-89727849 CAGCAGTGGGAAACTGGGGAAGG + Intronic
912481553 1:109985260-109985282 CTTCTGGGGGTGACTGGGGACGG + Intronic
912570807 1:110619606-110619628 CAGCAGGGAGAGACCGGGAGTGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914707816 1:150185569-150185591 CGTCAGGGGGAGGCAGGAGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915449155 1:155992699-155992721 TAGCAGGGGGAGGCCGGGTACGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
919162889 1:193853905-193853927 CATGAGGGGTAGACAGGGGCAGG + Intergenic
921132134 1:212228941-212228963 CAGCAGGGGCGGACCGGGGAGGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062925746 10:1314413-1314435 CTGCAGGGGCAGACCAGGGAGGG - Intronic
1063022707 10:2145707-2145729 CAGCAGGGGTTGACGGGGGAGGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063660979 10:8034935-8034957 CATCCGCGGGCGCCCGGGGAGGG + Intergenic
1063946405 10:11180494-11180516 CATCAGGAGGAGACTGAGTACGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1070975665 10:80603866-80603888 AATCTGGGGCAGACCCGGGACGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074106395 10:110392713-110392735 CATCAGGAGAGGACAGGGGAGGG - Intergenic
1076764827 10:132627328-132627350 CTTCACGGGGAGACCGGGGCCGG + Intronic
1077253234 11:1569965-1569987 CATCTGGGGGAGCCCAGTGAGGG - Intronic
1077473809 11:2777095-2777117 CATCATGGGGAGAGCCAGGAGGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG + Intronic
1084710416 11:70840559-70840581 CAAAAGGTGGAGACCTGGGAGGG + Intronic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088834342 11:113565267-113565289 CTTCAGGGAGATACTGGGGAAGG + Intergenic
1088858527 11:113778534-113778556 CAGCAAGGGGAGCCTGGGGAGGG + Intergenic
1089216113 11:116835687-116835709 CATCCGGGGGAGCCCGGGTGGGG - Intergenic
1089770962 11:120802612-120802634 CAGCAGGGGGAGGCTGGAGAAGG + Intronic
1090326203 11:125888075-125888097 GACCAGGCGGAGGCCGGGGACGG + Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091284758 11:134402443-134402465 CATCCTGGGGAGACGGGGCAGGG - Intronic
1091404264 12:199134-199156 CAGCAGGGGGAGGGTGGGGAGGG + Intronic
1091565034 12:1641963-1641985 CATCAGGTGGAGACCAGAGTGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093505200 12:19857141-19857163 GATGAGGGGGGGAGCGGGGAGGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097158710 12:57030447-57030469 CCTCAGGGAGAGGCCGGGGCTGG + Intronic
1097726391 12:63080022-63080044 CAGCAGGGAGAGAAAGGGGAGGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100368915 12:93947218-93947240 CATAAGGGGGAGAGGAGGGATGG - Intergenic
1101759420 12:107646541-107646563 CATCAGGGTGGGAGAGGGGAGGG + Intronic
1102825926 12:115947924-115947946 CACCAGGGGGAGACGAGTGAAGG + Intergenic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1110969204 13:81739769-81739791 CTTCTGTGGGAGACCAGGGAAGG - Intergenic
1111337511 13:86841445-86841467 CATCAGGGGGTGACTGGGCCTGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113909581 13:113835864-113835886 CAGCAGGTGGAGAGCTGGGAAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117566319 14:56997153-56997175 AATCAGGTGGAGACACGGGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122646940 14:103201108-103201130 CATCAGGGGGATAGTGGGGAGGG - Intergenic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1123947098 15:25244068-25244090 TCTCAGGGTGCGACCGGGGAGGG + Intergenic
1123947910 15:25247800-25247822 TCTCAGGGTGCGACCGGGGAGGG + Intergenic
1124490048 15:30150042-30150064 CACCAGGTGCAGACAGGGGAGGG - Intergenic
1124753484 15:32388285-32388307 CACCAGGTGCAGACAGGGGAGGG + Intergenic
1124975226 15:34523988-34524010 CACCAGGTGCAGACAGGGGAGGG + Intergenic
1125199674 15:37091884-37091906 CATTATTGGGAGACTGGGGAGGG - Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133467405 16:6041110-6041132 CTGCAGGGGGAGAGCAGGGAGGG - Intronic
1133627412 16:7584039-7584061 CATTATGGGGAGACAGGGCATGG + Intronic
1136299674 16:29325446-29325468 CATCTCGGGGGGACTGGGGAGGG - Intergenic
1136482791 16:30553073-30553095 CATCATGGGCAGAGCGGGGTAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137868934 16:51930889-51930911 CATCAGGGGAAGACCAGGTTGGG - Intergenic
1138458687 16:57135277-57135299 GATCAGGGGGAGGCAGGGGCTGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139234278 16:65318207-65318229 CATCAGGAGAAGATCGGGGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1141660361 16:85438047-85438069 CATCTGGGGGAGGCGGGAGAGGG + Intergenic
1142312576 16:89322660-89322682 CTTGAGGGGGACACTGGGGAGGG + Intronic
1142805147 17:2367535-2367557 CATCGGGGGCAGATCAGGGAGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143164542 17:4891433-4891455 CTGCAGGGAGAGACCAGGGAGGG - Intronic
1144409866 17:14990536-14990558 CACCAGTGGGAGACTGGGGTGGG - Intergenic
1144871787 17:18376538-18376560 CTTGAGGGGGAGCCAGGGGATGG - Intergenic
1145262756 17:21364645-21364667 CCACAGGGGGAAACCAGGGATGG - Intergenic
1146180977 17:30697972-30697994 CAGGAGGGGCAGCCCGGGGAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146645245 17:34572897-34572919 CATAAAGGGGAGACCCAGGAAGG - Intergenic
1148368123 17:47072077-47072099 CATCAGGGGAACGCCGGGAAAGG - Intergenic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1150397090 17:64830297-64830319 CATCAGGGGAACGCCGGGAAAGG + Intergenic
1151749503 17:76028527-76028549 CTTGAGGGGGAGCCAGGGGATGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152509442 17:80775532-80775554 CATCAGTGGGAAACCAGGGCTGG - Intronic
1152577764 17:81150398-81150420 GATCAGGGGGAGCCCTAGGATGG - Intronic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1154355599 18:13621497-13621519 GATCCAGGGGAGACCTGGGAGGG - Intronic
1157109633 18:44808475-44808497 CTTCAGGGGGAGACCTGAGGTGG + Intronic
1157905920 18:51570162-51570184 CAGCAAGGGGAGACAGGGGTGGG + Intergenic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159906561 18:74097638-74097660 CATCAGGTGGAGACAGGGCTAGG - Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1164231897 19:23296765-23296787 CATCAGGGCTAGTCAGGGGATGG - Intergenic
1164725885 19:30465342-30465364 CTTCAGGGGGTGACTGGGGAGGG - Intronic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1165948301 19:39458400-39458422 CCTCAGGGCCAGACCGGGGCTGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166297047 19:41894569-41894591 CAGCTGGGGAAGACAGGGGAGGG - Intronic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925057469 2:866408-866430 CCACAGGGAGAGACGGGGGAGGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926095951 2:10080534-10080556 CTGTAGGGGGAGACCCGGGAGGG - Intronic
926190351 2:10723016-10723038 GGTCAGGGGGAGACAGGAGAGGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929259967 2:39855116-39855138 GATCAGGGGAAGATTGGGGAAGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931697085 2:64879476-64879498 CAGCAGGGCGAGTCCAGGGAGGG + Intergenic
931704634 2:64937297-64937319 CATCACTGGGAAACCGGTGAGGG + Intergenic
931860074 2:66345821-66345843 CAGAAGGGGGATACTGGGGATGG - Intergenic
932399214 2:71468156-71468178 CATCAGGTGGACACTGGAGAAGG - Intronic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
935046849 2:99490201-99490223 CAACAGGGCGGGGCCGGGGAGGG - Intergenic
935270863 2:101433058-101433080 CAGATGGGGAAGACCGGGGAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937321025 2:120960843-120960865 CACCACTGGGAGACCAGGGAGGG - Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942687193 2:178545751-178545773 AATCAGGGGGAGAAGGGAGAAGG - Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944316531 2:198291099-198291121 CTACAGGGAGAGACCGAGGAGGG - Intronic
944399870 2:199313168-199313190 CATTAGGGGAAGATAGGGGAGGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946381971 2:219354990-219355012 CCTCAAGGTGAGACCTGGGAGGG - Intergenic
946416498 2:219542806-219542828 CCTCAGGGTGAGATGGGGGAGGG - Intronic
946798411 2:223382506-223382528 AATCAGGAAGAGACTGGGGAGGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1171229919 20:23475961-23475983 CAGCAGGGGGTGACGTGGGAGGG + Intergenic
1171510841 20:25683351-25683373 CATCTGGGGGAAATGGGGGAAGG + Intronic
1172033301 20:31996065-31996087 CACCAGGAGGAGGCCGGGCATGG - Intronic
1173285902 20:41671261-41671283 CAGCAGGCAGAGTCCGGGGAGGG + Intergenic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175216309 20:57393130-57393152 CACAAGGGGGAGGCCTGGGAGGG + Intronic
1175457325 20:59125252-59125274 CAGCAGGGTGAGGCCAGGGATGG - Intergenic
1176272325 20:64242348-64242370 TATCAAGGGGAGACCAGAGATGG - Intergenic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182567589 22:31211931-31211953 CATTAGGAGGAGAGCCGGGATGG - Intergenic
1183206958 22:36426319-36426341 CTCCAGGGGGAGACAGGGCAGGG - Intergenic
1183502075 22:38186538-38186560 CAGGAAGGAGAGACCGGGGAGGG + Intronic
1183736822 22:39649015-39649037 CAGCAGGTGGGGAGCGGGGAAGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184299037 22:43544080-43544102 GCTCAGGGGGAGGCTGGGGAGGG - Intronic
1184654233 22:45933101-45933123 CATCAGGGTGAGGACTGGGATGG + Intronic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
1185372544 22:50467699-50467721 GGTCAGGGGGAGACGGGGGCAGG + Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
950940116 3:16884169-16884191 GGTCAGGGGGCGACCGAGGAGGG + Intronic
951715814 3:25644707-25644729 CATCAGGGGGTGATGGGAGATGG + Intronic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
952139272 3:30459839-30459861 GATCTGGGGGAGTCCAGGGATGG + Intergenic
953134668 3:40172253-40172275 CATCAAGGGGATAGAGGGGAGGG + Intronic
954196848 3:49002122-49002144 CACCAGGGGGAGACCTGGTTAGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954574357 3:51667410-51667432 CATCACTGGGAGGCCGAGGAGGG - Exonic
957939945 3:86991325-86991347 CTGCAGGGGGACCCCGGGGAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960350875 3:116591133-116591155 CAGCTGGGGGAGAACGGGCACGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961057195 3:123799185-123799207 CATCAGGGGGTGAGGGGTGAGGG - Intronic
961160306 3:124718409-124718431 CATAATGGGGAGGCCGGGCACGG - Intronic
961491460 3:127259283-127259305 CATCAGGGGTCCACTGGGGATGG + Intergenic
962448588 3:135492213-135492235 AATTAGGGTGAGAACGGGGAAGG + Intergenic
962815591 3:138994955-138994977 CATCAAGGGGAGAAAGGAGAAGG - Intergenic
963160616 3:142148170-142148192 GATCTCGGGGAGACAGGGGAAGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969537423 4:7765282-7765304 CATCAGGTGGAGAACAGGCATGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976199097 4:82561808-82561830 CCGCAGGCGGAGACCGGGGACGG - Intronic
977352286 4:95903885-95903907 GATGAGGAGGAGACTGGGGATGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
981236214 4:142418854-142418876 CATCAGGTGGAGACTGAGCAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982331210 4:154183957-154183979 AAGCAGGTGGAGACGGGGGAAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984768000 4:183414171-183414193 GTTCAGGGGGAGGCCTGGGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
986482329 5:8202171-8202193 CTTCAGGGGGAGCTCCGGGAAGG + Intergenic
987001586 5:13665502-13665524 AATCAGTGGGAGAACTGGGAAGG + Intergenic
987366873 5:17156656-17156678 CATCAGAGTGAGATCAGGGAGGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991672285 5:69060384-69060406 CAGCAGGGGGTGATGGGGGATGG + Intergenic
993611641 5:90061457-90061479 CATCAGGGGCAGAGTGGTGATGG + Intergenic
995198556 5:109400476-109400498 CAGCAGGGGGAGGGGGGGGAAGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001568239 5:172714143-172714165 CCTCCGGGGGAGGCAGGGGAGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003442698 6:6158591-6158613 CTTCATGGGGAGGCCGGGGATGG - Intronic
1004056754 6:12146905-12146927 AATCAGGGAAAGACCGGTGATGG + Intronic
1004626158 6:17379286-17379308 CATCAGTGGGTGCCTGGGGATGG + Intergenic
1006985585 6:38173448-38173470 CATCAGAGGGCTACCGGGGCAGG - Exonic
1007720849 6:43884758-43884780 CAGCAGGGGCAGGCAGGGGAGGG - Intergenic
1007725721 6:43914563-43914585 CATCATGGGGGGACAGGGGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1012389936 6:98727029-98727051 CAACATGGGGACACTGGGGATGG - Intergenic
1012436440 6:99219943-99219965 CAGCAGGGGGAGTCCTGGGCTGG - Intergenic
1012710821 6:102602119-102602141 CATCAGTGAAAGACCGGAGAAGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1015093242 6:129384670-129384692 CAACAGGGGTAGACTGGAGATGG + Intronic
1016759413 6:147720476-147720498 GAGCTGGGGGAGACCGTGGAAGG - Intronic
1019158894 6:170056630-170056652 GATGAGGGGGAGACCCGGGGCGG - Intergenic
1019276868 7:180300-180322 CGTCAGGGGGACCCCAGGGAGGG + Intergenic
1019302928 7:317993-318015 CATCTGGTGCAGATCGGGGAAGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025964569 7:66256441-66256463 CATCAGGGCTCGACTGGGGAAGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1032046287 7:128611706-128611728 CATCGGGTGGGGACTGGGGAGGG - Intergenic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034291140 7:149932741-149932763 CAGCAGGGCGAGACAGGGCAGGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035344384 7:158188605-158188627 CATCAGGGGGCGAGCGTGGCGGG - Intronic
1036611006 8:10349895-10349917 CAAAAGGGGGTGACAGGGGAAGG - Intronic
1037739227 8:21592051-21592073 AAACAGGGGAAGACAGGGGAAGG + Intergenic
1037992560 8:23331171-23331193 CAAAGAGGGGAGACCGGGGAGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040087487 8:43360653-43360675 CATCTGGGGGTGACAGGAGATGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045960395 8:107961306-107961328 CATCAGAGGGTGACCTGGGTGGG + Intronic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047314830 8:123723171-123723193 CATCAGTGGGAGGCAGGGGGAGG + Intronic
1048413520 8:134200526-134200548 TATCAGGGAGAGACAGGGAAAGG + Intergenic
1049169458 8:141150009-141150031 CATCAAGGGAACACCTGGGAGGG - Intronic
1049258251 8:141625216-141625238 CATCAGGGGGAGCTGGGGAACGG + Intergenic
1049398528 8:142413055-142413077 CCTCAGGGGGAGGGCGGGGCTGG + Intergenic
1049613537 8:143566881-143566903 CATGAGGTGGAGACCCAGGAGGG + Exonic
1049644383 8:143729524-143729546 CATAAGGGGGAAACCGAGGCAGG + Intronic
1049671435 8:143871829-143871851 TCTCAGGGGGACCCCGGGGAGGG - Exonic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1055727946 9:79251625-79251647 CATTAGGGGAAGACTGGAGATGG - Intergenic
1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG + Intronic
1057492878 9:95536065-95536087 CATCAGTGGTAGACTGGGTAAGG + Intergenic
1058068091 9:100571813-100571835 CATCTGGGGGTGATGGGGGACGG + Intronic
1062729809 9:138102631-138102653 CAGCAGGAGGGGAGCGGGGAGGG - Intronic
1187217559 X:17291531-17291553 AAGCAGGGGGAGATAGGGGAAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190453763 X:50606222-50606244 CATGAGGGGGGGAGGGGGGAGGG - Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192353161 X:70373295-70373317 AAGGAGGGGGAGAACGGGGAGGG + Intronic
1192360062 X:70433806-70433828 CATCAGGGGGAGATGGGAGGAGG + Intergenic
1194902482 X:99530201-99530223 TGTCAGGGGGAGAGTGGGGAGGG + Intergenic
1197691235 X:129503142-129503164 AATCTTGGGGAGACTGGGGAAGG + Intronic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1199982438 X:152928374-152928396 CAGGGGTGGGAGACCGGGGAAGG + Intronic
1200238033 X:154478612-154478634 TAGCAGGGGGGGACCGGGGCTGG - Intronic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic