ID: 1013531401

View in Genome Browser
Species Human (GRCh38)
Location 6:111022185-111022207
Sequence CAAACATAACATTCTAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013531399_1013531401 26 Left 1013531399 6:111022136-111022158 CCTTATGGGGGGAAATATGCAAA 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1013531401 6:111022185-111022207 CAAACATAACATTCTAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013531401 Original CRISPR CAAACATAACATTCTAATTG AGG Intronic
No off target data available for this crispr