ID: 1013538904

View in Genome Browser
Species Human (GRCh38)
Location 6:111088096-111088118
Sequence GTGAGGCGCGGCGCCCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013538898_1013538904 19 Left 1013538898 6:111088054-111088076 CCTTCGGCTCCAAAGACGATGAC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1013538904 6:111088096-111088118 GTGAGGCGCGGCGCCCGCCGAGG 0: 1
1: 0
2: 0
3: 16
4: 312
1013538900_1013538904 10 Left 1013538900 6:111088063-111088085 CCAAAGACGATGACAAGATGGTC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1013538904 6:111088096-111088118 GTGAGGCGCGGCGCCCGCCGAGG 0: 1
1: 0
2: 0
3: 16
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013538904 Original CRISPR GTGAGGCGCGGCGCCCGCCG AGG Intronic
900095964 1:940245-940267 GGGAGGGGCGCCGGCCGCCGGGG + Intronic
901001011 1:6148813-6148835 GTGGGGCGGGGCGTCCGGCGCGG + Intronic
901437707 1:9258113-9258135 GGGAGGAGCGGCGCGGGCCGGGG + Intronic
902286040 1:15409580-15409602 GTGAGGAGCGGGGCTTGCCGGGG - Intergenic
903624373 1:24720485-24720507 GTGAGCCGCCGCGCCCGGCCTGG - Intergenic
903839191 1:26226054-26226076 GTGAGCCACCGCGCCCGGCGAGG - Intergenic
904011472 1:27392738-27392760 GTGAGTAGCGGGCCCCGCCGCGG + Intronic
904181769 1:28670753-28670775 GTGAGCCACTGCGCCCGGCGGGG + Intronic
904215397 1:28914769-28914791 GTGAGGCGAGGCGGCGGCGGCGG + Intronic
905639000 1:39576033-39576055 GTGAGCCGCGGCGCGGGCCCGGG - Exonic
906062633 1:42958507-42958529 GAGAGGCGCGCGGCCCGCCCCGG + Intronic
906343888 1:45003473-45003495 GTGAGGCGTGCCGCCGGCTGTGG - Exonic
906615760 1:47231968-47231990 GGGAGGGGCGGCGGCAGCCGGGG + Intronic
908751821 1:67430852-67430874 CTGAGGCGCCGCGCCGGCCGCGG + Intergenic
910788001 1:91021666-91021688 GTGAGCGGCGGCCGCCGCCGCGG - Intronic
910981249 1:92961556-92961578 GGGGAGCGCGGCGCGCGCCGCGG - Intergenic
913565674 1:120069843-120069865 TTAAGGCGCGGCGGCCCCCGGGG - Intergenic
913632455 1:120723711-120723733 TTAAGGCGCGGCGGCCCCCGGGG + Intergenic
914286270 1:146229217-146229239 TTAAGGCGCGGCGGCCCCCGGGG - Intergenic
914547298 1:148679959-148679981 TTAAGGCGCGGCGGCCCCCGGGG - Intergenic
916225244 1:162483332-162483354 GTGAGCCACTGCGCCCGCCAGGG + Intergenic
918062470 1:181073975-181073997 GTGAGCCGTGGCGCCCGGCTGGG - Intergenic
919640979 1:200042903-200042925 GTGAGCCGCGCCGCGCGTCGTGG + Intronic
921109117 1:212015085-212015107 GTGGGGGGCGGCCCCCGCCCGGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
921909068 1:220528222-220528244 CTGAGGCGCGGCGGCGGCGGTGG + Intronic
923631056 1:235649825-235649847 GGGAGGCGCGGCGCGGGGCGGGG - Exonic
1063180841 10:3598364-3598386 GTGAGCCGCTGCGCCCGGCCAGG + Intergenic
1065017282 10:21473813-21473835 GTGAGGCACCGCGCCCGGCTGGG - Intergenic
1065306053 10:24369981-24370003 GTGAGCCGCCGCGCCCGGCCAGG - Intronic
1066080712 10:31928541-31928563 GGGAGGCGCGGCGGCGGCGGCGG - Intronic
1069845347 10:71367179-71367201 GGGAGGCGGGGGGCCAGCCGTGG + Intergenic
1071695382 10:87863915-87863937 CTGAGGCGCGGCGGCGGCGGCGG + Exonic
1072562185 10:96586711-96586733 GTGAGGCGCCCCGGCCGGCGCGG - Intronic
1074801416 10:117004906-117004928 GGGAGACGTGGCGGCCGCCGTGG - Intronic
1074843329 10:117375638-117375660 GTGGGTGGCGGCGCGCGCCGCGG - Intergenic
1076050782 10:127331562-127331584 GTGAGCCACGGCGCCCGGCCCGG + Intronic
1076833166 10:133007109-133007131 GTGAGGAGCCACGCCTGCCGTGG + Intergenic
1076949748 10:133670938-133670960 GTGCAGCGCGGCCCCCGGCGGGG + Intronic
1076950732 10:133674237-133674259 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076951722 10:133677547-133677569 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076952711 10:133680857-133680879 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076953695 10:133684156-133684178 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076955668 10:133743818-133743840 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076956658 10:133747128-133747150 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076957645 10:133750437-133750459 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076959619 10:133757046-133757068 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076960603 10:133760345-133760367 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1077915947 11:6611783-6611805 GGGTGGCGCGGCGCCCCCGGAGG - Exonic
1079450313 11:20595818-20595840 GTGAGCCACTGCGCCGGCCGAGG + Intergenic
1081528611 11:43943270-43943292 GTAAGGGGCGCCGCCCGCGGGGG + Exonic
1083227756 11:61295308-61295330 GAGAGGCGCGGAGCCCGGGGCGG + Exonic
1083560915 11:63672112-63672134 GTGAGGCACGGCGCCCGGCCTGG - Intergenic
1083940080 11:65891047-65891069 GTGCGGCGCGCCGCCCGCGCTGG - Exonic
1084171271 11:67401965-67401987 GTGAGGCGCGGCGGCCCGGGGGG + Intronic
1085294831 11:75425486-75425508 GAGGGGCGCGGCGGCCGCCCAGG + Exonic
1085559700 11:77459976-77459998 GTGAGCCACCGCGCCCGGCGTGG + Intronic
1087800298 11:102496411-102496433 GTGAGCCACCGCGCCCGGCGTGG - Intronic
1088920757 11:114258371-114258393 CTGAGGCCCGGCGCCAGCAGAGG + Intronic
1089212172 11:116812275-116812297 GTGAGCCACTGCGCCCGGCGTGG - Intergenic
1090385556 11:126355920-126355942 GGGAGGCGCGGCGCCGGCTGGGG - Intronic
1090588703 11:128241827-128241849 GTGAGCCACCGCGCCCGCCCAGG - Intergenic
1091225793 11:133956022-133956044 GAGAGGCGCGGGGGCCGGCGGGG + Intronic
1091286570 11:134411768-134411790 GCGCGGCGGGGCGCCCGCGGGGG + Intronic
1091718424 12:2795567-2795589 GCGGGGCGAGGCGACCGCCGCGG + Intronic
1092462358 12:8697879-8697901 CTGAGGAGCGGCGCGCGCCCCGG - Intronic
1092485413 12:8898494-8898516 GTGAGCCACCGCGCCCGGCGAGG - Intergenic
1094338966 12:29389535-29389557 GGGAGACGCGGCGGCCGGCGGGG - Intergenic
1096634353 12:52949060-52949082 GTGAGGCCCCGCCCCCGCCCCGG - Exonic
1096685909 12:53288192-53288214 GTGAGGAGCGGCGTCCCCAGAGG + Exonic
1101365292 12:104064777-104064799 GGGAGGCGAGGCGGCGGCCGCGG + Intronic
1101940776 12:109097812-109097834 GTGAGGCGCGGCTTGGGCCGGGG + Intronic
1102006915 12:109595063-109595085 GAGAGGCGTGGCCCACGCCGAGG - Exonic
1103547521 12:121712714-121712736 GTGGGGCGGGGCGGGCGCCGGGG + Intergenic
1103600769 12:122053276-122053298 GTGAGCCGCCGCGCCCGGCCAGG + Intronic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103807434 12:123584431-123584453 GGGAGGCACGGCAGCCGCCGAGG - Intergenic
1105070049 12:133228681-133228703 GTGAGGGGAGGCTCCAGCCGTGG + Intronic
1105725944 13:23162330-23162352 GTGAGCCACCGCGCCCGCCCAGG - Intergenic
1107084079 13:36406703-36406725 GTGAGCCACGGCGCCCGACCAGG - Intergenic
1109543512 13:63811694-63811716 GGGAGGCGCGGAGCCCGCTCAGG + Intergenic
1111351402 13:87036103-87036125 GTGAGGCACCGCGCCCGGCCCGG - Intergenic
1114525899 14:23366580-23366602 GAGAGGCGCGGGGACGGCCGGGG - Intergenic
1115502224 14:34060168-34060190 GTGTGGCTCGGTGTCCGCCGCGG - Intronic
1118761382 14:68882331-68882353 CTGAGGCCCGGAGCCCACCGTGG - Intronic
1119743353 14:77027951-77027973 GCGAGGCGCTGCGCCGGCGGTGG - Exonic
1121764038 14:96470098-96470120 GTGAGCCACCGCGCCCGCCCGGG + Intronic
1122256083 14:100477807-100477829 GTGAGCCACGGCGCCCGGCTGGG - Intronic
1122399540 14:101458699-101458721 GCGACCCGCGGCGCCCCCCGCGG + Intergenic
1122418405 14:101561077-101561099 GCGCGGCTCGGCGGCCGCCGGGG + Intergenic
1123802356 15:23834423-23834445 GTGAGCCACTGCGCCCGGCGTGG + Intergenic
1124506673 15:30282961-30282983 GTGAGCCACGGCGCCCGGCCAGG - Intergenic
1124629357 15:31327939-31327961 GCGACGCGCGGGGCCAGCCGCGG - Intronic
1124736884 15:32255675-32255697 GTGAGCCACGGCGCCCGGCCAGG + Intergenic
1126668496 15:51094939-51094961 GGGAGGCGCGGCGCCGCCCCCGG - Intronic
1130115625 15:81002178-81002200 CTGAGTCGCGACGGCCGCCGGGG + Exonic
1130370862 15:83284508-83284530 GGTAAGCGCGGCGCCCTCCGCGG - Exonic
1130776208 15:86986204-86986226 GTGAGCCACGGCGCCCGGCCAGG + Intronic
1130893421 15:88152016-88152038 GTGAGCCACGGCGCCCGGCTGGG - Intronic
1131503665 15:92996440-92996462 GTGAGCCACCGCGCCCGCCTGGG + Intronic
1132490676 16:228987-229009 CGGAGCCGCGGCGCCCGCCGGGG + Intronic
1132541738 16:512962-512984 GTGAGCCACTGTGCCCGCCGAGG + Intronic
1132641759 16:981454-981476 GAGCCGCGCGGCGCCCGCAGAGG + Intergenic
1132750019 16:1453293-1453315 GTGAGGCACCGCGCCCGGCCAGG + Intronic
1132956397 16:2596474-2596496 GTGAGCCACGGCGCCCGGCCGGG + Intronic
1133188392 16:4116159-4116181 GTGCGCCGCCGCTCCCGCCGCGG + Exonic
1136454026 16:30370287-30370309 GCGCGGCTCGGCGCGCGCCGGGG + Intergenic
1136719764 16:32310600-32310622 GTGAGGCGGGGCGCACGGGGAGG - Intergenic
1136779135 16:32886068-32886090 GCGAGTCGCTGAGCCCGCCGCGG - Intergenic
1136838139 16:33516880-33516902 GTGAGGCGGGGCGCACGGGGAGG - Intergenic
1136891482 16:33975450-33975472 GCGAGTCGCTGAGCCCGCCGCGG + Intergenic
1137300533 16:47144034-47144056 GCGAGGCGCGGCGCGGGGCGGGG - Intergenic
1137623720 16:49894198-49894220 GTGAGCCACGGCGCCCGGCTAGG - Intergenic
1138229115 16:55324778-55324800 GTGAGGCGCGGCGCGGCGCGGGG - Exonic
1138327895 16:56191133-56191155 GTGGGGCCGGGCGCGCGCCGGGG - Intergenic
1139926541 16:70490939-70490961 GTGAGCCACTGCGCCCGGCGAGG + Intronic
1141531137 16:84648149-84648171 GAGAGGCGCGGTGCCCGTCCCGG + Intergenic
1142207856 16:88792494-88792516 GTGAGGCGCAGAGCCCTGCGTGG + Intergenic
1142350293 16:89576433-89576455 GTGAGGGGCGCCGGCCGACGGGG + Intronic
1203006667 16_KI270728v1_random:207169-207191 GTGAGGCGGGGCGCACGGGGAGG + Intergenic
1203081548 16_KI270728v1_random:1148156-1148178 GCGAGTCGCTGAGCCCGCCGCGG - Intergenic
1203148308 16_KI270728v1_random:1817160-1817182 GTGAGGCGGGGCGCACGGGGAGG - Intergenic
1142580401 17:938397-938419 GTGAGCCGCCGCGCCCGGCCGGG - Intronic
1142585695 17:971883-971905 GTGAGCTGCGGCGCCCGGCCAGG - Intronic
1142586717 17:979038-979060 GTGCTGCGCTGCGCCCGCCCTGG - Intronic
1142649700 17:1340312-1340334 GTGAGCCGCCGCGCCCGGCCTGG - Intergenic
1142848190 17:2692103-2692125 GGGAGGCGCGGCGCGGGGCGAGG + Intronic
1142915451 17:3132928-3132950 GTGAGGCACCGCGCCCGGCCTGG - Intergenic
1143174365 17:4947982-4948004 GAGGGGCGCGGCGCCCGGTGCGG - Intronic
1143742630 17:8965603-8965625 GAGGGGCTCGGCGCCCGGCGGGG - Exonic
1144903038 17:18615898-18615920 GTGAGCCGCCGCGCCCGGCCTGG - Intergenic
1144928023 17:18830085-18830107 GTGAGCCGCCGCGCCCGGCCTGG + Intergenic
1145243590 17:21253277-21253299 CTGCGGCGCGGCGCCGGCGGGGG + Exonic
1145884719 17:28373982-28374004 GTGAGCCACGGCGCCTGGCGGGG - Intronic
1146262399 17:31430639-31430661 GTGAGCCACCGCGCCCGCCCTGG + Intronic
1147259504 17:39200562-39200584 GTGCGGTGCGGCACCAGCCGGGG - Intronic
1147657365 17:42098484-42098506 GGGAGGGGCGGGGCCCGGCGGGG + Intergenic
1147659144 17:42107915-42107937 GTCAGGGGCGGGGCCTGCCGGGG - Intronic
1147996775 17:44363878-44363900 GTGTGGCGCGCCGCCTGCAGGGG - Intergenic
1148410003 17:47458009-47458031 GTGAGCCACCGCGCCCGGCGAGG - Intergenic
1148768940 17:50056042-50056064 GGGAGGCGGGGCGCGCGCCGGGG + Intronic
1148899654 17:50866356-50866378 GAGAGGCGGGGCGCGCGCCGCGG - Intronic
1150268006 17:63843073-63843095 GTTAGGGGCGGTGCCCGCTGGGG - Intergenic
1152114604 17:78377977-78377999 GTGAGCCACTGCGCCGGCCGAGG + Intergenic
1152552026 17:81034841-81034863 GGGAGGCGCGGCGCGGGCTGGGG - Intergenic
1152715731 17:81899659-81899681 GTGAGGGGAGGCGCCTGCTGCGG + Intronic
1153565702 18:6415031-6415053 GGGTGGCGCTGGGCCCGCCGAGG + Intronic
1156008447 18:32470486-32470508 GCGAGCAGCGGCGGCCGCCGAGG - Intergenic
1156150217 18:34233322-34233344 GTGAGCCGCAGCGCCCGGCCTGG - Intergenic
1157095093 18:44680170-44680192 GGGAAGCGCGGGGCCGGCCGGGG + Intronic
1157829017 18:50839714-50839736 GTGAGGAGCTGTGCCCACCGAGG - Intergenic
1158920410 18:62186329-62186351 GTGAGCCACCGCGCCCGGCGTGG + Intronic
1160735083 19:658725-658747 GTGAGGCGGGGCCCCAGCCTGGG - Intronic
1160788699 19:913050-913072 GCGGGGCGCGGCGGGCGCCGGGG - Intronic
1161245529 19:3249625-3249647 GTGAGGGGCGGGGCCAGCCCCGG - Intronic
1161256924 19:3314859-3314881 GAGTGGAGCGGGGCCCGCCGTGG + Intergenic
1161272203 19:3396187-3396209 GTGAGCCGCCGCGCCCGGCCCGG - Intronic
1161345006 19:3764363-3764385 GTGAGCCGCCGCGCCCGGCCGGG + Intronic
1161846583 19:6714577-6714599 GTGAGCCGCTGCGCCCACCTGGG - Intronic
1161969928 19:7572476-7572498 ATGAGCCACGGCGCCCGGCGAGG + Intergenic
1162027763 19:7904103-7904125 GCGGGGCGGGGCGCGCGCCGCGG + Intronic
1162388042 19:10372273-10372295 GTGAGCCACGGCGCCCGGCCTGG + Intronic
1162576566 19:11502749-11502771 GTGAGCCACTGCGCCCGGCGGGG - Intronic
1162954462 19:14090528-14090550 CCGAGGCGCTGCGCCCCCCGGGG - Exonic
1163113822 19:15177796-15177818 GCGCTGCGAGGCGCCCGCCGCGG - Exonic
1163594785 19:18214664-18214686 GTGAGCCACGGCGCCCGGCTGGG - Intronic
1163743991 19:19033931-19033953 GTGAGACGCTGCGGCTGCCGAGG + Exonic
1163827507 19:19532020-19532042 GTGAGGCACCGCGCCCGGCCTGG + Intronic
1164498686 19:28793593-28793615 GGGAGGCGCGGCGGCCCCTGCGG + Intergenic
1165524479 19:36342135-36342157 GTGAGCCACTGCGCCCGGCGAGG + Intronic
1166538908 19:43593019-43593041 GTGAGAGGCGGCGGCCGCGGTGG + Exonic
1166809686 19:45507809-45507831 GCGGGGCGCGGAGCCCGCCCGGG - Intronic
1166811628 19:45517885-45517907 GTGAGGGGCGGCGGGCGCAGGGG - Intronic
1166975045 19:46601060-46601082 GGGAGGCGGGGCGCGCGGCGAGG + Intronic
1166975098 19:46601251-46601273 GCGAGGCGGGGCGCGCGCGGCGG + Exonic
1166995313 19:46717164-46717186 GAGAGGGGCGGAGCCTGCCGAGG + Intergenic
1167337425 19:48895595-48895617 GTGAGCCACGGCGCCTGGCGGGG - Intronic
1167369737 19:49073312-49073334 GTGAGCCACGGCGCCCGGCCTGG + Intergenic
1167649049 19:50719634-50719656 GAGGGGCGCGGCGGCCGCGGCGG - Intergenic
926086852 2:10025789-10025811 GTGAGCCACTGCGCCCGACGTGG - Intergenic
926847164 2:17154337-17154359 GTGAGCCACGGCGCCCGGCGTGG - Intergenic
926901214 2:17753780-17753802 GGGAGCCCCGGCGCCCACCGCGG + Exonic
927230743 2:20822423-20822445 GTGAGCCACGGCGCCCGGCCAGG + Intronic
927472245 2:23385328-23385350 CTCAAGCGCGGCGACCGCCGGGG - Exonic
930700715 2:54456402-54456424 GTGAGCCCCGGCCCCAGCCGCGG + Exonic
932773916 2:74515871-74515893 GTGAGGCGCGGCGCGGGCGAGGG + Intronic
936511751 2:113153997-113154019 GTGAGCCGCCGCGCCCGACCAGG - Intergenic
936516486 2:113184649-113184671 GTGAGCCACTGCGCCCGCCATGG + Intronic
937989929 2:127656695-127656717 GTGAGCCGCCGCGCCCGGCCAGG + Intronic
941295712 2:163736388-163736410 GCGAGGCTGGGCGGCCGCCGCGG - Intergenic
942077038 2:172365542-172365564 GTGAGCCACGGCGCCCGGCCAGG + Intergenic
942320015 2:174728621-174728643 GTGAGGCACCGCGCCCGGCCAGG + Intergenic
942453320 2:176122007-176122029 GTGAGGCTGGGCACACGCCGCGG - Intergenic
944221750 2:197310514-197310536 GGGCGGCGCGGAGCCCGGCGGGG - Intronic
946358876 2:219207043-219207065 GTGAGGGGCGGAGCGCGCGGGGG + Intronic
946412792 2:219523334-219523356 TGGAAGCGCGGCGCCCGCCGGGG + Intronic
946623771 2:221589168-221589190 GTGAGCCACGGCGCCCGTCCAGG + Intergenic
1169023061 20:2344496-2344518 GTGAGCCGCCGCGCCCGGCCTGG - Intergenic
1171013635 20:21521962-21521984 GAGGGGCGCGGCACCCGCGGCGG - Intergenic
1172024792 20:31940933-31940955 GTGAGCCACCGCGCCCGGCGAGG - Intronic
1179874209 21:44259414-44259436 GTGAGGCGAGGGGCCTGCCCAGG - Intronic
1180559179 22:16601821-16601843 GTGAGGGGCGCCGGCCTCCGGGG - Intergenic
1180875210 22:19171919-19171941 GAGAGGCGCTGTGCCCGCCAGGG - Intergenic
1182294458 22:29305030-29305052 GTGAGCCGCCGCGCCCGGCCGGG + Intergenic
1183452756 22:37905913-37905935 GGGTGGCGCGGCGGCGGCCGCGG + Intronic
1184545448 22:45164297-45164319 GTGAGGAGCGGCGGCGGGCGCGG + Intronic
1184759682 22:46537420-46537442 TTGATGCGCGGCGCCCTCCCGGG - Intergenic
950002606 3:9668855-9668877 GTGAGGCATGGCGCCCGGCCCGG - Intronic
950460188 3:13116616-13116638 GTGAGGCACTGCGCCCGGCCGGG - Intergenic
950652737 3:14417447-14417469 GTGAGCCACGGCGCCCGGCCTGG - Intronic
954656683 3:52198270-52198292 GGTAGGTGCGGCGCCGGCCGAGG + Intronic
954838898 3:53494530-53494552 GCGCGGCGCGGCGCGGGCCGTGG + Intergenic
956813595 3:72888210-72888232 GTGCGGCGCGGCGGCGGCGGCGG - Exonic
961798466 3:129426644-129426666 GTGAGCCACGGCGCCCGGCCGGG + Intronic
962211799 3:133485916-133485938 GTGAGCCACGGCGCCCGGCCAGG - Intergenic
962808999 3:138946176-138946198 GTGCGGCGTGGCGGGCGCCGGGG - Exonic
966598370 3:181748704-181748726 GTGAGCCGCCGCGCCCGGCCAGG - Intergenic
967558141 3:190883952-190883974 GTGAGCCACCGCGCCCGCCCTGG + Intronic
967930304 3:194686155-194686177 CTGCTGCGCGGGGCCCGCCGCGG + Intergenic
969240372 4:5893105-5893127 GCGGGGCGTGGCGCGCGCCGGGG + Intergenic
969379107 4:6782805-6782827 GGGCGGCGCGGCGGCCGGCGGGG - Exonic
970763985 4:19524770-19524792 GTGAGCCACGGCGCCCGGCCAGG - Intergenic
971999187 4:34008213-34008235 GTGAGCCACGGCGCCCGGCCTGG - Intergenic
972633539 4:40862576-40862598 GTGAGCCGCGGTGCCCGGCTAGG - Intronic
974273731 4:59688158-59688180 GTGAGCCACGGCGCCCGGCCTGG - Intergenic
975132987 4:70846773-70846795 GTGAGGCACTGCGCCCGGCCAGG - Intergenic
978885389 4:113761583-113761605 CTCAGGCGCGGGGCGCGCCGGGG + Intronic
984801604 4:183721947-183721969 GTGAGCCGCCGCGCCAGCCTGGG - Intergenic
985129226 4:186724452-186724474 GGGAGGCCAGGCGCCCGCGGCGG - Intronic
985452218 4:190068423-190068445 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985453202 4:190071720-190071742 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985454192 4:190075013-190075035 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985455180 4:190078306-190078328 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985456168 4:190081606-190081628 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985457152 4:190084900-190084922 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985458139 4:190088193-190088215 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985459128 4:190091493-190091515 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985463381 4:190174262-190174284 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985964050 5:3326219-3326241 TTAAGACGCAGCGCCCGCCGCGG - Intergenic
986721600 5:10564396-10564418 GGGACGCGGGGCGCGCGCCGAGG - Intronic
988588247 5:32526465-32526487 GTGAGCCACCGCGCCCGGCGTGG - Intergenic
992990431 5:82278128-82278150 ATGAGGCGTGGAGGCCGCCGAGG - Intronic
997470646 5:134115182-134115204 GCGCGGCGCGGCGACCGCGGGGG - Intronic
997984491 5:138492038-138492060 GCGAGGCTCGGTGCCCGCAGAGG + Intergenic
998151432 5:139759633-139759655 GCGTGGCGCGGCGCCCGCCACGG - Intergenic
999234941 5:150084994-150085016 GTGAGTCACGGCGCCCGGCCTGG - Intronic
999730821 5:154475787-154475809 GTGAGCCGAGGCCCGCGCCGAGG - Exonic
1000052639 5:157575782-157575804 GGGAGGCGCGGGGCGAGCCGGGG - Intergenic
1002281022 5:178130256-178130278 GTGAGCCGCCGCGCCCGGCCTGG + Intergenic
1004864348 6:19838198-19838220 GAGAGGCCGGGCGCCGGCCGTGG + Intronic
1005383578 6:25263009-25263031 GTGAGCCACGGCGCCCGGCCGGG - Intergenic
1005883146 6:30075200-30075222 GTGAGGCTGGGCGCGCGTCGCGG - Intronic
1006351048 6:33521553-33521575 GCAAGGGGCGGCGCCCGTCGGGG + Intergenic
1006617943 6:35342565-35342587 GTGTGACGCTGCGGCCGCCGCGG + Intronic
1007023221 6:38543673-38543695 GTGAGCCACCGCGCCCGGCGGGG - Intronic
1007582392 6:42967249-42967271 GTGAGCCACGGCGCCCGCGCTGG + Intronic
1007902041 6:45422017-45422039 GGGGGGAGCGGCGGCCGCCGCGG + Intronic
1008378692 6:50819889-50819911 GCGAGGCGCGGGGCGCGCGGCGG + Intronic
1008699529 6:54081693-54081715 GTGAGGCACCGCGCCCGGCCAGG + Intronic
1012519182 6:100100179-100100201 GTGAGCCACGGCGCCCGGCCAGG - Intergenic
1013538904 6:111088096-111088118 GTGAGGCGCGGCGCCCGCCGAGG + Intronic
1013556320 6:111260191-111260213 GTGAGCCACGGCGCCCGGCCCGG + Intronic
1014137730 6:117907900-117907922 GTGAGCGGCGGCGCCGGGCGAGG + Intronic
1017467102 6:154704787-154704809 GTGAGCCGCGGCGCCTGGCCAGG - Intergenic
1017810625 6:157981486-157981508 GGGAGGCGCAGCGCCCCCGGCGG + Intergenic
1018313920 6:162538114-162538136 GTGAGCCACCGCACCCGCCGAGG - Intronic
1019111828 6:169723715-169723737 CTCAGGCGCGGCGCCCGGCCTGG + Intronic
1019305608 7:332984-333006 GTGGAGCGCGGGGCCCGCCGGGG + Intergenic
1019362786 7:614044-614066 GGGAGGCGTGGCGCCCACAGAGG + Intronic
1019828252 7:3301402-3301424 GAGGGGCGCGGCGCGGGCCGGGG - Intergenic
1019879828 7:3848950-3848972 GTGAGCCGCCGCGCCCGGCCTGG + Intronic
1020192353 7:6009666-6009688 GTGAGCCACGGCGCCCGGCCTGG - Intronic
1022121698 7:27314634-27314656 GTGAGGAGCTGCGCCCGCCTGGG - Intergenic
1022923264 7:35037190-35037212 GCCCGGCGCGCCGCCCGCCGGGG - Intronic
1023221242 7:37921381-37921403 GAGGGGCGCTGCGCCCACCGAGG + Intronic
1023382759 7:39624177-39624199 GTGAGGCGCGGGGACTGCGGCGG - Intronic
1024578876 7:50785638-50785660 GTGAGGCGGGGTGCCCGCGGTGG - Intronic
1025829643 7:65038257-65038279 ATGGGGCGCGGCGGCGGCCGCGG + Intergenic
1026084144 7:67249017-67249039 GTGAGCCACCGCGCCCGGCGCGG + Intergenic
1026484650 7:70807651-70807673 GTGAGCCACCGCGCCCGGCGAGG + Intergenic
1026765018 7:73154959-73154981 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1026941592 7:74290404-74290426 GGGAGGGGCGGCGGCCGCGGAGG + Intronic
1027041490 7:74964714-74964736 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1027082152 7:75237655-75237677 GCGGCGCGCGGCGCCCGGCGCGG + Intergenic
1029282965 7:99448588-99448610 GTGATGCGCGGGGCCAGGCGTGG - Intronic
1029333289 7:99878242-99878264 GTGAGCCGCCGCGCCCGGCCAGG - Intronic
1029423418 7:100483428-100483450 GTGAGGCGCTGGGGCCGCCAGGG - Intergenic
1030532778 7:110730805-110730827 GTGAGCCGCCGCGCCCGGCCGGG + Intronic
1031899429 7:127392835-127392857 GCGACGCGCTGTGCCCGCCGCGG + Intronic
1032765369 7:134986712-134986734 GTAAGGCGGGGCGCCCCCTGCGG + Intronic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1034227880 7:149497356-149497378 ATGGGGCGCGGGGTCCGCCGGGG - Intronic
1034478630 7:151303270-151303292 GTGAGCCGCTGCGCCCGGCCGGG + Intergenic
1034618106 7:152436108-152436130 GTGAGGGGCGCCGGCCCCCGGGG + Intergenic
1035283486 7:157792257-157792279 GAGAGGCCAGGCGCCCGCAGCGG + Intronic
1035356702 7:158280027-158280049 GTGGGGCGTGGGGGCCGCCGCGG - Intronic
1035512966 8:206383-206405 GTGAGGCGCGGCGCAGGCGCAGG + Intergenic
1035580764 8:738031-738053 GGGATGCGCGGAGCCCGGCGAGG - Intronic
1036390280 8:8318835-8318857 GGGAGGCGCGGCGGCGGCGGGGG + Exonic
1037997152 8:23361179-23361201 GTGAGGCACTGCGCCCGGCCTGG + Intronic
1038964432 8:32555751-32555773 GTGAGCCACCGCGCCCGGCGGGG + Intronic
1039557211 8:38485109-38485131 GTGAGCCACGGCGCCCGCCCTGG - Intergenic
1039921304 8:41896247-41896269 GTGGGGCGCGGCGCCCGGTGCGG - Intronic
1039948157 8:42147581-42147603 GTGAGCCACGGCGCCCGGCCTGG + Intergenic
1042721117 8:71827714-71827736 GTGAGGCACGGCACCCGACTAGG - Intergenic
1043955916 8:86359765-86359787 GTGAGCCACTGCGCCCGCCGAGG - Intronic
1049079571 8:140431172-140431194 GTGAGCCACCGCGCCCGGCGAGG - Intronic
1049168956 8:141146126-141146148 GTGAGCCACCGCGCCCGCCCTGG + Intronic
1049682595 8:143926302-143926324 GTGAGGCGAGGCGGCCAGCGTGG + Intronic
1052486769 9:29110969-29110991 GTGAGCCACGGCGCCCGGCCTGG + Intergenic
1052942694 9:34142797-34142819 GTGAGCCGCCGCGCCGGCCCAGG + Intergenic
1054765029 9:69036014-69036036 GGGAGGCGCCGCGCACGCCGGGG + Intronic
1057686325 9:97238052-97238074 GTGAGCCACGGCGCCCGGCCTGG + Intergenic
1057781715 9:98056020-98056042 GTGAGCCACCGCGCCCGCCCAGG + Intergenic
1060770105 9:126326598-126326620 GGGAGGCGGGGTGCCGGCCGGGG + Intergenic
1061321827 9:129835640-129835662 GAGAGGGGCGGCGGCGGCCGGGG - Intronic
1061851251 9:133417297-133417319 GTGAGGCCCCGCGCCCGGCCTGG + Intronic
1062084502 9:134641820-134641842 GTGAGGTCCTGCGCCAGCCGCGG - Exonic
1062549439 9:137079179-137079201 GTGAGGGGCGGGGCCAGCCTCGG - Intronic
1062594940 9:137295395-137295417 GGGAGGCGGGGCGGGCGCCGGGG - Intergenic
1062636788 9:137495723-137495745 GTGAGCCGCCGCGCCCGGCCTGG + Intronic
1185505850 X:631812-631834 GTGAGGCACCGCGCCCGGCCTGG + Intronic
1185890099 X:3815615-3815637 GAGAGCCGCGGCACCCGCTGCGG - Intergenic
1187173000 X:16870005-16870027 CTGCGGGGCGGCGCGCGCCGGGG - Intronic
1188692119 X:33142365-33142387 GTGAGCCGCTGTGCCCGGCGAGG + Intronic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1197627911 X:128823744-128823766 GTGAGCCGCTGCGCCCGGCCCGG - Intergenic
1199771207 X:150976330-150976352 GTGAGCCACGGCGCCCGACCGGG - Intergenic
1200100642 X:153687953-153687975 GCGAGTCGCTGAGCCCGCCGCGG + Intronic