ID: 1013545061

View in Genome Browser
Species Human (GRCh38)
Location 6:111148643-111148665
Sequence CTGTAGTTCTTTACAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013545059_1013545061 -2 Left 1013545059 6:111148622-111148644 CCAAATGTCTCCAAAGGTTTGCT 0: 1
1: 0
2: 2
3: 15
4: 193
Right 1013545061 6:111148643-111148665 CTGTAGTTCTTTACAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013545061 Original CRISPR CTGTAGTTCTTTACAGAAGT TGG Intronic
No off target data available for this crispr