ID: 1013545154

View in Genome Browser
Species Human (GRCh38)
Location 6:111149345-111149367
Sequence ACAGTGGCATAGCCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013545154_1013545159 18 Left 1013545154 6:111149345-111149367 CCTCAGCAAGGCTATGCCACTGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1013545159 6:111149386-111149408 GGTAGTGTCATTCTCAGTGTAGG No data
1013545154_1013545160 30 Left 1013545154 6:111149345-111149367 CCTCAGCAAGGCTATGCCACTGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1013545160 6:111149398-111149420 CTCAGTGTAGGCTGTTTGATAGG No data
1013545154_1013545156 -3 Left 1013545154 6:111149345-111149367 CCTCAGCAAGGCTATGCCACTGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1013545156 6:111149365-111149387 TGTCATGACTCTCCTATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013545154 Original CRISPR ACAGTGGCATAGCCTTGCTG AGG (reversed) Intronic
904486281 1:30826346-30826368 AGTGTGGCATAGCCCTGCTTTGG + Intergenic
905382596 1:37573796-37573818 CCAGTGCCATGGCCTTGCTAGGG - Intronic
906557879 1:46728750-46728772 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
906801585 1:48742451-48742473 TCAGTAGCGTAGCTTTGCTGGGG - Intronic
908219459 1:61989733-61989755 ACACTGGCCTAGACTTTCTGTGG - Intronic
908556428 1:65261247-65261269 ACAGAGACATTGCCTTGTTGTGG + Intronic
909287016 1:73832263-73832285 ACAGTGGCATATAGGTGCTGTGG - Intergenic
909874383 1:80783949-80783971 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
912698312 1:111857564-111857586 TCAGAGGCATAGATTTGCTGAGG - Intronic
912966268 1:114239985-114240007 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
913036275 1:114969371-114969393 ACAGTGGCTTTGCCATGCTGTGG + Intronic
915397225 1:155594547-155594569 ACAGTGGCCTTGTCATGCTGAGG + Intergenic
915514591 1:156405509-156405531 AAAGTGTCTTAGCCTTCCTGAGG + Intronic
915738149 1:158097676-158097698 CCAGTGGAATAGCTTTTCTGGGG + Intronic
916362895 1:163990691-163990713 ACAGTGGCTTTGCCAAGCTGCGG - Intergenic
917032432 1:170708374-170708396 ACAGTCGCATATCCTTGGAGAGG + Intronic
917971600 1:180211534-180211556 ATAGTGGCAGGACCTTGCTGTGG + Intergenic
917983990 1:180296193-180296215 AAAGAGCCAGAGCCTTGCTGTGG - Intronic
919307215 1:195856701-195856723 GCTGTGGCATGGCTTTGCTGGGG - Intergenic
920502030 1:206491505-206491527 CCAGAGACATAGCCCTGCTGTGG + Exonic
921304685 1:213784006-213784028 GCAGTAGCAAAGCCTTGTTGTGG - Intergenic
1067692833 10:48513322-48513344 ACAATGGCATAGCGCTGCTCAGG - Intronic
1072160011 10:92757272-92757294 ACAGTTGCATTGGCTTCCTGTGG - Intergenic
1074428491 10:113372918-113372940 ACTGTGGGGTAGCCTTGCTGGGG - Intergenic
1078137443 11:8663087-8663109 ACAGTGGCCTAGCCATGCAGTGG - Intronic
1078512666 11:11997188-11997210 ACAGTGGTACAGCCGTGCTCTGG - Intronic
1078998362 11:16727996-16728018 ACAGTGGCTTTGCGGTGCTGAGG - Intronic
1080834285 11:35926175-35926197 ACACTGGCATTGTCTGGCTGGGG - Intergenic
1081086275 11:38805410-38805432 ACAGTTGCATAGCCTATCAGAGG + Intergenic
1084406071 11:68974437-68974459 CCAGTGGGATAGCACTGCTGGGG + Intergenic
1084947298 11:72645206-72645228 ACTGTGCCATAGACTTGCTGTGG + Intronic
1085768857 11:79307625-79307647 AGAGTGGCTGAGCCATGCTGGGG - Intronic
1086300316 11:85420663-85420685 ACAGTGGCTTTGCCAAGCTGTGG + Intronic
1087540412 11:99510345-99510367 AAACTGGCATAACCTTTCTGAGG + Intronic
1088924095 11:114283080-114283102 AGACTGGTATAGCCTTGCTGGGG + Intronic
1089037703 11:115412651-115412673 AAAGTGGCACAGCCCTCCTGTGG - Intronic
1089447190 11:118562773-118562795 AACGTGGCATAGGCTTGGTGCGG + Intronic
1091518949 12:1216578-1216600 TCATTGACATAGCCTTGGTGGGG + Intronic
1092216176 12:6684717-6684739 ACAGTGGCATAGCATTTCTCAGG - Intronic
1092601709 12:10073322-10073344 ACAGTGGCAAGGCCTGGCTGTGG - Exonic
1099607600 12:84825388-84825410 ACAGTGGCGTAGCCTGCATGAGG - Intergenic
1101296106 12:103425094-103425116 ACAGTGGCTTTGCCGAGCTGTGG - Intronic
1101296231 12:103425834-103425856 ACAGTGGCTTTGCCGAGCTGTGG + Intronic
1103939892 12:124495860-124495882 ACAGGGTCATAGCCTTGCCCAGG - Intronic
1104115581 12:125746276-125746298 ACAGTGGCTTTGCCAAGCTGTGG + Intergenic
1104639185 12:130456529-130456551 ACTGTGGGAAAGGCTTGCTGGGG + Exonic
1104986487 12:132600497-132600519 TCAGGGACACAGCCTTGCTGTGG - Intergenic
1104990409 12:132621158-132621180 ACACTGGCATAGCTGTGGTGGGG + Intronic
1105769429 13:23594512-23594534 ACAGTGGCTTTGCCAAGCTGTGG - Intronic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1106874213 13:34054501-34054523 ACAGTGGCTTTGCCATGCTGTGG + Intergenic
1107235360 13:38162029-38162051 AAAGTGGAAAAGCCTTGCTTTGG + Intergenic
1109187919 13:59292107-59292129 ACAGTGGCTTTGCCAGGCTGCGG - Intergenic
1113435465 13:110287656-110287678 ACAGTGGGATGGCCTTGCCTGGG + Intronic
1115162320 14:30410181-30410203 ACAGTGGCTTTGCCAAGCTGTGG + Intergenic
1115414069 14:33111117-33111139 ACAGTGGCAGAGCCTTCCAAGGG - Intronic
1118888752 14:69889226-69889248 ACAGTGGTTCAGCCCTGCTGAGG - Intronic
1120014362 14:79453597-79453619 ACAGTAGCACAGTCTTGCTTGGG + Intronic
1122262097 14:100529516-100529538 ACTGAGGCCAAGCCTTGCTGGGG + Intronic
1123160591 14:106274957-106274979 GCAGTGGGAGAGCCTTCCTGGGG - Intergenic
1123202432 14:106679490-106679512 GCAGTGGGAGAGCCTTACTGGGG - Intergenic
1127373754 15:58363309-58363331 ACAGTGGCTTTGCCAAGCTGTGG - Intronic
1127596834 15:60492752-60492774 ACACTGGCATAACTTTGCTTTGG + Intronic
1128397463 15:67242833-67242855 GGAGTAGCATAGACTTGCTGAGG + Intronic
1130441945 15:83963416-83963438 ACAGTGGCTTTGCCAAGCTGTGG - Intronic
1134767599 16:16774473-16774495 ACAGTGGCCTTGCTTAGCTGCGG + Intergenic
1136931260 16:34419833-34419855 ACAGGGGCAGAGCCCTGCTGTGG - Intergenic
1136973313 16:34991986-34992008 ACAGGGGCAGAGCCCTGCTGTGG + Intergenic
1139979284 16:70840679-70840701 AAAGAGGCAAAGCCTTTCTGGGG + Intronic
1141045828 16:80715504-80715526 CCAGTGGCACTGCCCTGCTGTGG + Intronic
1141250871 16:82357992-82358014 AGAGAGGCATAGGCTTGATGAGG - Intergenic
1142003158 16:87675547-87675569 GCAGTGGCACAGCCGTGCTGTGG + Intronic
1142542178 17:668292-668314 ACTGTGCCATAGCCTTGCTTAGG - Intronic
1142994645 17:3753479-3753501 GCAGGGGTGTAGCCTTGCTGAGG - Intronic
1147525283 17:41216576-41216598 ACAGTGGCTTTGCTGTGCTGAGG - Intronic
1148726175 17:49792004-49792026 ACTCTGGCTTAGCCTGGCTGAGG - Exonic
1149403319 17:56321394-56321416 AAAGTGGCATTCCCTTACTGTGG - Intronic
1153798484 18:8647134-8647156 ACAGTGGCTTTGCGGTGCTGCGG - Intergenic
1157591548 18:48839130-48839152 ACAGTGGCCTAGCCGAGCCGTGG - Intronic
1160065672 18:75572091-75572113 ACTGTGGCACATCCATGCTGTGG - Intergenic
1160157144 18:76442593-76442615 ACAGCGGCAGAGTCCTGCTGCGG - Exonic
1162511667 19:11122728-11122750 ACAGTGGCTTAGGCTGGGTGAGG - Intronic
1166710178 19:44931788-44931810 ATAGTGACATTGCCTGGCTGAGG - Intergenic
1167180406 19:47898853-47898875 ATAGTGGCATAGCCCAGATGGGG + Intergenic
925208451 2:2026797-2026819 ACACTGGCATAGCCTTGTGCGGG + Intronic
927945445 2:27132555-27132577 AAAGAGGCATAGCCCAGCTGTGG - Intronic
928279415 2:29930955-29930977 GCAATGGCACAGCCTGGCTGGGG - Intergenic
929256116 2:39813405-39813427 ACAGTGGCTTTGCCGTGCTGTGG + Intergenic
932194127 2:69768348-69768370 GCAGTGGCAAAGCCTACCTGTGG + Intronic
934882600 2:97996353-97996375 ACAGTGGTAGAGCCTTCCAGGGG + Intergenic
939117913 2:138081819-138081841 ACTGTGGCATAACCATACTGTGG - Intergenic
939186606 2:138868611-138868633 CCAGTGGCATAGCCTTACTGAGG - Intergenic
939558176 2:143702043-143702065 ACAGTGGGATTGTCTTGCTAAGG + Intronic
940179955 2:150921074-150921096 ATTGTGGTATAGCCTTGCTGTGG + Intergenic
940361444 2:152800355-152800377 GCAGAGGCAAAGGCTTGCTGGGG + Intergenic
940408069 2:153328535-153328557 ACAGTGGCTTTGCCATGCTTTGG + Intergenic
940602623 2:155880617-155880639 ACAGTGGCTTTGCCAAGCTGCGG - Intergenic
941646557 2:168047302-168047324 AAAATGGTATAGCCATGCTGTGG + Intronic
945559583 2:211322103-211322125 GCTGTGGTATAGCTTTGCTGGGG - Intergenic
946065294 2:216982436-216982458 ACAGTGGCTTTGCAGTGCTGTGG + Intergenic
946204090 2:218090886-218090908 ACTGTGGCATATCCATGCGGTGG - Intergenic
946290014 2:218737632-218737654 ACGGTCTCATGGCCTTGCTGAGG - Exonic
946622270 2:221572955-221572977 ACAGTGACGGAGCCCTGCTGCGG - Intronic
1170052024 20:12156509-12156531 CCAGTGGAATAGCCTAGATGGGG - Intergenic
1175132019 20:56796428-56796450 GCAGTGGCCAAGCCTTGCTCTGG + Intergenic
1178393586 21:32219884-32219906 ACAGTGGTTTTGCCGTGCTGTGG - Intergenic
1180029677 21:45197701-45197723 ACGGTGGCATATCCATGCAGTGG + Intronic
1182255140 22:29032399-29032421 AAAGTGGCTTGGCCTTGTTGTGG - Intronic
1182843503 22:33411277-33411299 ACAGAGACATTTCCTTGCTGTGG - Intronic
950522894 3:13506923-13506945 TCAGTGGCACAGCCTGGATGGGG + Intergenic
951741696 3:25931878-25931900 ACAGTGGCTTTGCCTAGCTGCGG - Intergenic
952281386 3:31926631-31926653 AAAATGGCACAGGCTTGCTGTGG + Intronic
953997825 3:47534344-47534366 AAAGAGACAAAGCCTTGCTGGGG - Intergenic
955507846 3:59649416-59649438 GCAGTGGCATGGTCTTACTGAGG - Intergenic
956383045 3:68686186-68686208 ACAGCGGCTTTGCCTAGCTGTGG + Intergenic
958793605 3:98682280-98682302 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
960560902 3:119083186-119083208 GCAGTGGCATGATCTTGCTGCGG + Intronic
962642338 3:137400554-137400576 ACACTGGCTTTGCCTAGCTGCGG + Intergenic
963371869 3:144411825-144411847 GTAGTGGTATGGCCTTGCTGGGG + Intergenic
964185942 3:153942731-153942753 ACAGAGGTATGGCCTTGCTCTGG + Intergenic
965496083 3:169400998-169401020 ACAGTGCCATACCCTGTCTGAGG + Intronic
967521356 3:190436456-190436478 ACAGTCCCATAACCTTGGTGTGG + Intronic
968829081 4:2922869-2922891 ACAGTGGCTTTGCATAGCTGCGG + Intronic
969168570 4:5340029-5340051 ACAGTGGCATTTCCCTGCTTGGG - Intronic
970486913 4:16534007-16534029 ACAGCAGCATAGCCTTTGTGTGG + Intronic
976057262 4:81082607-81082629 AGACTGGCATAGCCTTTCTCAGG - Intergenic
976690241 4:87861080-87861102 ACAGTGAAATACACTTGCTGTGG - Intergenic
976715961 4:88122571-88122593 ACAGTGGCTTTGCCAAGCTGTGG - Intronic
977631453 4:99247925-99247947 ACAGTGGCTTTGCTGTGCTGTGG + Intergenic
977887906 4:102273354-102273376 ACAGTGGCTTTGCCGAGCTGTGG - Intronic
978108292 4:104930968-104930990 ACAGTGGCTTAGCCAAGCTGTGG - Intergenic
980723573 4:136728133-136728155 CCAGTGCCCTATCCTTGCTGTGG + Intergenic
981083268 4:140656585-140656607 AAAGAGACAAAGCCTTGCTGGGG - Intronic
981254710 4:142648142-142648164 GCAGTTTCATAGCCTTGCAGTGG - Intronic
983299013 4:165901976-165901998 ACAGTGGCTTTGCCGAGCTGTGG + Intronic
983543311 4:168935670-168935692 ACAGTGGCTTTGCCAAGCTGTGG - Intronic
983767276 4:171499856-171499878 GCAGTGGCATAGCTTTGCTGGGG - Intergenic
984269806 4:177536843-177536865 ACAGTGGCTTTGCCAAGCTGTGG + Intergenic
986675208 5:10178067-10178089 ACAGTGGCTTTGCCAAGCTGCGG - Intergenic
986729097 5:10622133-10622155 ACAATGCAATTGCCTTGCTGTGG + Intronic
988719233 5:33859417-33859439 ACAGTGGCATTGCTGAGCTGCGG - Intronic
989320695 5:40130783-40130805 ACAGTGGCTTTGCCAAGCTGTGG + Intergenic
991318460 5:65339171-65339193 ATGGTGGCATAGCTTTGCCGGGG - Intronic
992316947 5:75566097-75566119 ACAGTGGCCTTGCCAAGCTGTGG + Intronic
996394653 5:123001240-123001262 AATGGGGCATAGCCATGCTGTGG + Intronic
999228546 5:150047624-150047646 GCAGTGGCAGTGCCTTGGTGAGG + Exonic
999461940 5:151764754-151764776 AAATTAGCATAGCCTTTCTGAGG - Intronic
1000798359 5:165693142-165693164 ACAGTGGCTTTGCACTGCTGCGG + Intergenic
1003711037 6:8590497-8590519 ACTCTGACATAGACTTGCTGCGG + Intergenic
1004250735 6:14021422-14021444 ACAGTGGCTTCTCCTTCCTGGGG - Intergenic
1004421154 6:15471095-15471117 ACAGTGGCATAGCTTTTCCCAGG + Intronic
1006820771 6:36892757-36892779 ACAGTGGCATAGACCTGCAAGGG - Intronic
1007251488 6:40498133-40498155 ACAGTGACAGAGCCTTTCGGTGG - Intronic
1008425207 6:51349039-51349061 ACAGTGGCTTTGCTGTGCTGTGG + Intergenic
1008563146 6:52741506-52741528 ACAGTGGCTTGGCATTCCTGGGG - Intergenic
1008719168 6:54327875-54327897 ACAGTGGCTTTGCTGTGCTGTGG - Intronic
1010055559 6:71560136-71560158 GCAGTGGTATGGCTTTGCTGGGG + Intergenic
1011301425 6:85878639-85878661 ACAGTGGCTTTGCTTAGCTGCGG + Intergenic
1011766283 6:90623515-90623537 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
1012207451 6:96478636-96478658 ACAGTGGCTTTGCCAAGCTGTGG + Intergenic
1013545154 6:111149345-111149367 ACAGTGGCATAGCCTTGCTGAGG - Intronic
1014177009 6:118342275-118342297 ACAGTGGCTTTGCCAAGCTGCGG + Intergenic
1014696939 6:124633915-124633937 GCTGTGGCATATCTTTGCTGGGG - Intronic
1015427144 6:133084084-133084106 ACAGTGGCATAGGCTTCCAGTGG + Intergenic
1016593223 6:145769104-145769126 ACATTTGTATAGTCTTGCTGTGG + Intergenic
1018399265 6:163405809-163405831 ACAGAGGCAGGGCCTGGCTGGGG + Intergenic
1021014684 7:15518073-15518095 ACAGTGGCTTTGCCAAGCTGCGG - Intronic
1022013404 7:26328673-26328695 ACAGTGGCATATTCTTGGTGGGG - Intronic
1022693364 7:32680461-32680483 ACAGTTGCAGAGACTTGCAGTGG - Intergenic
1022848442 7:34235367-34235389 ACAGTGGCTTTGCCAAGCTGCGG + Intergenic
1024621600 7:51162813-51162835 ACAGAGGCTTAGCCTGGCGGAGG - Intronic
1026710075 7:72729886-72729908 GCAGTGGCATGGCTTTGCTAGGG - Intronic
1028520230 7:91721426-91721448 GCTGTGGCAAAGCTTTGCTGGGG - Intronic
1030141016 7:106304218-106304240 ACAGTGGCTTTGCCGAGCTGTGG + Intergenic
1030771091 7:113475641-113475663 ACAGTGGCTTTGCCATGCTGTGG + Intergenic
1031613748 7:123856917-123856939 ACAGTGGCTTTGCCGAGCTGTGG + Intronic
1033917485 7:146345980-146346002 ACAGAGGCAGAGCTTTGCGGAGG - Intronic
1034358408 7:150472507-150472529 AGGGTGCCATGGCCTTGCTGTGG + Intronic
1034883758 7:154782039-154782061 GCAATGGCACAGCCTGGCTGAGG - Intronic
1035998297 8:4573854-4573876 ACAGTGGCTTTGCCGTGCAGTGG + Intronic
1037605052 8:20431155-20431177 ACAGTGTCATAGTGTTGCTCTGG - Intergenic
1038633632 8:29268181-29268203 ACAGTAGCACAGCGTAGCTGGGG - Intergenic
1041666334 8:60448476-60448498 ACAGTGGCTTTGCCGAGCTGTGG - Intergenic
1046047951 8:108986294-108986316 ACAGTGGCTTTGCAGTGCTGTGG + Intergenic
1047217948 8:122894136-122894158 ACAGTGGCATGGCCCTTCTGGGG + Intronic
1047934904 8:129767113-129767135 CCAGTGGTATAGCCTCCCTGTGG + Intronic
1052241397 9:26277812-26277834 ACAGTGGCTTTGCCATGCTGTGG - Intergenic
1052337739 9:27337196-27337218 AGAGGGCCTTAGCCTTGCTGTGG - Intronic
1054948806 9:70825680-70825702 ACAGTGGCCTGGCCTCCCTGAGG - Intronic
1055259056 9:74411413-74411435 ACAGTGCCATAGGCTTGGGGAGG + Intergenic
1059507604 9:114813819-114813841 CCCTTGGCATGGCCTTGCTGGGG + Intergenic
1060108905 9:120892514-120892536 ACACTGGCACACCATTGCTGAGG - Intronic
1061574763 9:131499250-131499272 ACAGGTGCACAGCCATGCTGTGG + Exonic
1062192425 9:135254836-135254858 ACAGTGGCCCAGCCCTGCAGAGG - Intergenic
1186852266 X:13592330-13592352 AAAGTGGAAAAACCTTGCTGGGG + Intronic
1188561223 X:31470881-31470903 ACAGTGGCTTTGCCGAGCTGCGG + Intronic
1190131848 X:47755134-47755156 ACAGTGAAATATCCCTGCTGAGG + Intergenic
1190457428 X:50639789-50639811 TCAGAAGAATAGCCTTGCTGGGG + Intronic
1191119757 X:56891030-56891052 ACAGTGGCTTTGCCATACTGTGG - Intergenic
1191153274 X:57243161-57243183 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
1192675438 X:73191173-73191195 AGAGTGTCATAGTCTTGCTCTGG + Intergenic
1194355805 X:92882381-92882403 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
1194725941 X:97397508-97397530 ACTCAGGCATAGCCCTGCTGAGG + Intronic
1194798373 X:98240570-98240592 ACAGAGGCTTTGCCTGGCTGTGG + Intergenic
1195489874 X:105454877-105454899 ACTGTAGCATGGCTTTGCTGGGG - Intronic
1196946570 X:120832793-120832815 ACAGTGGCTTTGCCAAGCTGTGG + Intergenic
1197880732 X:131164142-131164164 ACAGTGGCGTTGCCCAGCTGCGG + Intergenic
1197972304 X:132127947-132127969 ACAGTGGGAATGCCTGGCTGGGG - Exonic
1199367313 X:147002365-147002387 ACAGTGTTATAGCATTGCTGGGG - Intergenic
1200664152 Y:5999362-5999384 ACAGTGGCTTTGCCAAGCTGTGG - Intergenic
1201462286 Y:14239706-14239728 AAAGTGGCTTTGCCATGCTGTGG - Intergenic