ID: 1013545588

View in Genome Browser
Species Human (GRCh38)
Location 6:111153810-111153832
Sequence TCTTATCTTTGTAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013545588_1013545591 20 Left 1013545588 6:111153810-111153832 CCTTTCTCCTTACAAAGATAAGA 0: 1
1: 0
2: 2
3: 39
4: 339
Right 1013545591 6:111153853-111153875 TTAGGCTTCCTGATCATTATTGG 0: 1
1: 0
2: 1
3: 4
4: 130
1013545588_1013545590 2 Left 1013545588 6:111153810-111153832 CCTTTCTCCTTACAAAGATAAGA 0: 1
1: 0
2: 2
3: 39
4: 339
Right 1013545590 6:111153835-111153857 CTTGCTTTGAGTATATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013545588 Original CRISPR TCTTATCTTTGTAAGGAGAA AGG (reversed) Intronic
902259903 1:15217011-15217033 TCTTATCTTTATAGTGGGAAGGG + Intronic
902606559 1:17572511-17572533 ACTTAGCTTTGTAAGTAAAAGGG - Intronic
903565201 1:24259857-24259879 TCATTTCTTTTTAAGGAAAAAGG - Intergenic
905086532 1:35384085-35384107 TCTTATCTTTCTCAGGAGACAGG - Intronic
906917608 1:50027965-50027987 CCTTATCTGTGTGAGGAGAATGG - Intergenic
908025878 1:59951058-59951080 ACGTACCTTTGTAAGGAGCATGG + Intergenic
908435578 1:64102425-64102447 ACTTCTCTTTGTGAGAAGAAAGG - Intronic
910707889 1:90149036-90149058 TATTCCCTTTTTAAGGAGAATGG + Intergenic
910719272 1:90267689-90267711 TCTTATCTTTGTGAGAATACAGG - Intergenic
910897606 1:92084922-92084944 ACATATCTTTGTAAGGAACATGG + Intronic
911200354 1:95037720-95037742 TCTTACCATTTTAAGGACAAAGG - Intronic
913668852 1:121075750-121075772 AATTATAGTTGTAAGGAGAATGG + Intergenic
914020596 1:143863183-143863205 AATTATAGTTGTAAGGAGAATGG + Intergenic
914659094 1:149771101-149771123 AATTATAGTTGTAAGGAGAATGG + Intergenic
917038124 1:170771953-170771975 TCTTATATTTGCTATGAGAATGG + Intergenic
917382747 1:174432265-174432287 TCATATCTTTTGCAGGAGAATGG - Intronic
917815992 1:178710988-178711010 GCATATGTTTGTAAGAAGAATGG + Intergenic
918073510 1:181151447-181151469 TCTTATCTGTGAAATGGGAATGG + Intergenic
920243649 1:204572204-204572226 CCTTACCATGGTAAGGAGAATGG + Intergenic
921503721 1:215940040-215940062 TATAATCTTTGTCATGAGAATGG - Intronic
922361798 1:224829381-224829403 TCTTCAGTTTGTTAGGAGAAAGG + Intergenic
924588905 1:245384585-245384607 CCTTATCTTTAAAATGAGAATGG - Intronic
924817557 1:247456006-247456028 TCTTAGCATTGAGAGGAGAAGGG + Intergenic
1064835150 10:19518693-19518715 AATTATCTTTGTCAGCAGAAAGG + Intronic
1065602554 10:27384488-27384510 TCCTTTCTTTGAAAAGAGAAAGG - Intergenic
1066312379 10:34210521-34210543 TCTTCTCCTTGTAAGTAGAAAGG - Intronic
1068776068 10:60869740-60869762 TCTTATCGATGGAAGGAGAAAGG - Exonic
1069014659 10:63415583-63415605 TTTTATTTTTGTAAGGTGATAGG + Intronic
1070156989 10:73841297-73841319 TCTTATTATGGGAAGGAGAAGGG + Intronic
1070656168 10:78273072-78273094 TCTTCTGTTTGTACAGAGAAGGG - Intergenic
1070753886 10:78979758-78979780 TCTTAACTCTGTAAGAATAAGGG - Intergenic
1070804127 10:79260747-79260769 CATTAGCTTTATAAGGAGAATGG + Intronic
1073357089 10:102865245-102865267 TTTTATCTTTATAAGGAGCTGGG - Intronic
1073964001 10:108967363-108967385 TGTTATCATTGACAGGAGAAAGG + Intergenic
1074473494 10:113748470-113748492 TCTGATGTTTGTAAAGAGAAAGG - Intergenic
1074662840 10:115681860-115681882 TTTTTGCTGTGTAAGGAGAAAGG + Intronic
1075380184 10:122012596-122012618 TGTTATCTATGTAAGTAGAAAGG + Intronic
1077721534 11:4635243-4635265 TCGTATCTTTGTAGGGAGGGTGG - Intergenic
1080274013 11:30483224-30483246 ACTTATCTTTTTAAGGGAAATGG + Intronic
1080634634 11:34112873-34112895 TCTTGTCTTTTTTGGGAGAATGG - Intronic
1080995774 11:37599035-37599057 TCTTATCCTGGAAAGTAGAAAGG + Intergenic
1081071895 11:38621069-38621091 TCTTTTGTTTATAAGTAGAAGGG + Intergenic
1081324807 11:41730920-41730942 ATTTATCTCAGTAAGGAGAAGGG + Intergenic
1081557125 11:44175085-44175107 TCTCATCTTAGTGTGGAGAATGG + Intronic
1082972876 11:59042209-59042231 TCTTATTTTTGTAATGAAACTGG + Intronic
1082977280 11:59085778-59085800 TCTTATTTTTGTAATGAAACTGG + Intergenic
1083077856 11:60059652-60059674 TATTAGCTTTCTAAGGATAATGG + Intronic
1084077256 11:66789518-66789540 CCTTATCTTCTTTAGGAGAATGG + Intronic
1085929941 11:81069922-81069944 TGTTGTGTTTGCAAGGAGAAGGG - Intergenic
1086432465 11:86748750-86748772 TCTATTCTTCGTAAGCAGAAGGG + Intergenic
1086609660 11:88740535-88740557 CCTTATCTTTGAAATGAGTATGG - Intronic
1086882232 11:92162188-92162210 TCTTATCATTGTAGGGAACAGGG + Intergenic
1088040854 11:105380045-105380067 TGTTATCTGTGTAAGCAGAGTGG + Intergenic
1088603905 11:111511112-111511134 TCTTATCTTTGTGAGGGGCACGG - Intronic
1089419648 11:118321922-118321944 GCATATTTTTGTAAGAAGAAAGG - Intergenic
1090233100 11:125124256-125124278 GCTTTTCTTTGGAAGGAGAAAGG + Intergenic
1090562877 11:127951614-127951636 TCTTAAATTTAAAAGGAGAAGGG - Intergenic
1092883436 12:12905797-12905819 TCTGTCCTTTGTCAGGAGAAAGG - Intronic
1094198921 12:27778436-27778458 TTTTACCTTAGGAAGGAGAAAGG - Intergenic
1094653937 12:32402773-32402795 TTTTATCATGGTAAGGGGAATGG - Intronic
1095153655 12:38825743-38825765 TCTTTTCTATGTAAGACGAAGGG + Intronic
1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG + Intergenic
1096200769 12:49680935-49680957 TGTTTTCTTTGTAAGGAGATGGG - Intronic
1096440678 12:51640697-51640719 TCTGATGTTTCTGAGGAGAAAGG + Intronic
1096864078 12:54550859-54550881 TCTTTTTTTTCTAAGGAGCAGGG - Intronic
1096914753 12:55019706-55019728 TCTTATCTTTTTAATCACAAAGG + Intergenic
1097196847 12:57247218-57247240 TATTCTCCTTCTAAGGAGAATGG + Intronic
1097871135 12:64603194-64603216 CTTTATCTTTCAAAGGAGAAAGG + Intergenic
1098306373 12:69106855-69106877 TCTTATCTGTGCAATGAGTATGG + Intergenic
1099713550 12:86261893-86261915 TCTTGTTCTTATAAGGAGAAAGG + Intronic
1099807888 12:87543197-87543219 TCTTCTCTCTTTAAGAAGAAAGG - Intergenic
1100255569 12:92879820-92879842 CCTTATCTGTGGGAGGAGAATGG - Intronic
1100529567 12:95451266-95451288 ACTTATCTTTTTAAGTAGGAAGG + Intergenic
1101292480 12:103385764-103385786 TTTCATACTTGTAAGGAGAATGG + Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1104292297 12:127481764-127481786 TCTTGTCTTGGGAAGGAGATGGG + Intergenic
1104496030 12:129239974-129239996 TCTTCTCTTTGCAAGGAAAAGGG + Intronic
1106121957 13:26867397-26867419 TTTTGTCTTTGTATGGAGAATGG - Intergenic
1107250260 13:38351112-38351134 TCTTAACTATATAAGGAGTAAGG - Intronic
1108187730 13:47905079-47905101 TCTTTTGTTTGCAAGCAGAAAGG + Intergenic
1108650394 13:52472626-52472648 TCTTTTCTTTTTTGGGAGAAAGG - Intronic
1110066245 13:71110036-71110058 TCCAATCTTGGTAAGGAGGAGGG + Intergenic
1110704551 13:78589555-78589577 TCTCATCTTTTCATGGAGAAAGG + Intergenic
1110876618 13:80517933-80517955 TGTTATCCTTTGAAGGAGAAGGG - Intergenic
1111179501 13:84644465-84644487 TCTTGTCTTCATAAGTAGAATGG - Intergenic
1111586409 13:90289174-90289196 TCATGTCTTTGTAAGGAGAGAGG + Intergenic
1114285040 14:21233368-21233390 TCTTAACTTTGTAAAAACAAAGG + Intronic
1114612028 14:24049043-24049065 TCTCATCCATGTAAGGAGAGAGG - Intergenic
1114839003 14:26240315-26240337 TCTTATCTTTGGAAGGATTCTGG - Intergenic
1115227813 14:31122877-31122899 TCCTATCTTTGTAAAGAGAATGG + Intronic
1115228700 14:31134032-31134054 TTTTTTTTTTTTAAGGAGAATGG - Intronic
1115428708 14:33291062-33291084 GCTTTACTCTGTAAGGAGAATGG + Intronic
1116241132 14:42344522-42344544 CCTTATCTTAGTGAGGATAATGG + Intergenic
1117239688 14:53817371-53817393 TCTCATCTTTATAAGCAGTATGG + Intergenic
1118142587 14:63100782-63100804 TCTTATCTTTGTGGGCAGAAGGG - Intronic
1118179432 14:63477157-63477179 TCTTAATTTTTTAATGAGAATGG - Intronic
1118522666 14:66603598-66603620 TCCTATTTTTGTATGGTGAAGGG + Intronic
1118553686 14:66987856-66987878 TCTTATTTTTAAAAGGAAAAAGG + Intronic
1120320830 14:82958110-82958132 GCTTATTCTTATAAGGAGAAGGG - Intergenic
1120645939 14:87074086-87074108 TCTTATCTATGGAACGTGAAAGG - Intergenic
1120819459 14:88898789-88898811 GCTTTTCTTTCAAAGGAGAACGG + Intergenic
1121375620 14:93407594-93407616 CCTTATCTGTGTTAGGAGAAGGG + Intronic
1121444995 14:93973112-93973134 TCTTCTCTTTGTATGGAGTAGGG + Intronic
1121859372 14:97302203-97302225 TCTTATCTTTAAAATGAGAGAGG + Intergenic
1122189001 14:100025114-100025136 TCTTATCTTAAAAAGGAAAATGG - Intronic
1123693200 15:22856774-22856796 GCTGATCTTTGTTAGGAGTATGG - Intronic
1124485990 15:30117122-30117144 TCGTATCTATATTAGGAGAAGGG - Intergenic
1124517585 15:30380147-30380169 TCGTATCTATATTAGGAGAAGGG + Intronic
1124541065 15:30586108-30586130 TCGTATCTATATTAGGAGAAGGG - Intergenic
1124757593 15:32421476-32421498 TCGTATCTATATTAGGAGAAGGG + Intergenic
1126166814 15:45660476-45660498 GCTTCTCTTTGTAAGGAGACTGG + Intronic
1126580096 15:50234805-50234827 GCCTGTCATTGTAAGGAGAAAGG - Intronic
1126880223 15:53086514-53086536 TTTTTTTTTTGTATGGAGAAAGG + Intergenic
1127111130 15:55671859-55671881 TCCTATCTTTGTAGAGTGAAAGG - Intronic
1127559447 15:60121411-60121433 TCTTATCATTTTAAGTTGAAAGG + Intergenic
1127713922 15:61628842-61628864 TCTTATCTTTTGAAAAAGAAAGG + Intergenic
1127719509 15:61686047-61686069 TCTAAGCTCTGTAAGGACAATGG - Intergenic
1128371366 15:67041950-67041972 GCTTCTCTTTCTAAAGAGAAGGG + Intergenic
1128472934 15:67971188-67971210 GCTTATACTTGTAAGTAGAAAGG + Intergenic
1129949896 15:79576366-79576388 TCTTGAATTTATAAGGAGAAAGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130525756 15:84704928-84704950 TTTTCTCTTTTTAAAGAGAAAGG + Intronic
1130526531 15:84711806-84711828 TCTTACCTTTGTTTGGAGTACGG - Intronic
1131860907 15:96652409-96652431 TCTGAGCTTTGTATGGAAAAGGG + Intergenic
1132126158 15:99226985-99227007 TCTTTTCTGTGTAACTAGAATGG - Intronic
1132947816 16:2541925-2541947 TCTTCTCTTAGTGAGGAGAAAGG + Intronic
1132966625 16:2659412-2659434 TCTTCTCTTAGTGAGGAGAAAGG - Intergenic
1133182729 16:4070642-4070664 TTTTTTCTTTTTAAAGAGAAAGG - Intronic
1137920206 16:52479704-52479726 TCATATCTTTCCATGGAGAAGGG - Intronic
1138369471 16:56514880-56514902 TCTTAGCCTTGTAAGGAACAAGG + Intronic
1138768122 16:59628624-59628646 TCTTGTCTTTGGAAGGGCAATGG + Intergenic
1139043542 16:63029660-63029682 TTTTATCTTTTTCAGGAAAATGG + Intergenic
1140450115 16:75063988-75064010 TCTTTTCTTTTTAAAGAGACAGG + Intronic
1143566953 17:7727991-7728013 TCTTTTCTTTGTACGTAGAGTGG - Intronic
1143740344 17:8948269-8948291 CTTTACCATTGTAAGGAGAATGG + Intronic
1146198406 17:30832493-30832515 TCCTGACTTTGTAAGGGGAAAGG + Intronic
1146249743 17:31328642-31328664 TCCTAACTTGGTAAGGAGAGGGG - Intronic
1146597092 17:34178966-34178988 TTTTTTTTTTGGAAGGAGAAAGG - Intergenic
1149392576 17:56206817-56206839 TCTTAACTTTGCAAGTAGAGAGG - Intronic
1149676353 17:58466289-58466311 ACTTTTCTTTTTAAGGAGAAAGG - Intronic
1151659500 17:75511331-75511353 TCTTTTCTTTTTAAAGAGATAGG - Intronic
1153471855 18:5455307-5455329 TTTTACCTATGTAAAGAGAAGGG - Intronic
1153611239 18:6887384-6887406 TCTTGTCTTCCTCAGGAGAAGGG - Intronic
1154043318 18:10880276-10880298 TCTGGTCTTTGACAGGAGAATGG - Intronic
1155336180 18:24767597-24767619 ACTTCACTTTGTAAGCAGAATGG + Intergenic
1155426030 18:25708529-25708551 TCATAGCTTGATAAGGAGAATGG - Intergenic
1155859443 18:30878489-30878511 TCTGACCTTTGTCAGGAGCAAGG + Intergenic
1155875481 18:31081535-31081557 TTTCATCATTGTAAGGAAAATGG + Intronic
1157107629 18:44789700-44789722 CCTTATCTATGAACGGAGAAGGG + Intronic
1157198100 18:45636412-45636434 TCTTTTCCTTGGAAGGAGAATGG - Intronic
1157267080 18:46234847-46234869 TCTTCTCTTAGTGAGGAGATTGG + Intronic
1159549247 18:69877605-69877627 TCTTACCTTGGTCAGGAGAAAGG + Intronic
1160814039 19:1027153-1027175 TCTTAGCTTTGGGAGGGGAAGGG + Intronic
1161189774 19:2947122-2947144 TCTTACATCTGTAAGGAGTAAGG - Intergenic
1162933529 19:13968974-13968996 TCTCCTCTCTGTTAGGAGAATGG + Intronic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1165039018 19:33055691-33055713 TCTTCTCTCTGCAAGGAGCAGGG - Intronic
1166194956 19:41199384-41199406 TCTTTTCTTTTTAAAGAGACAGG + Intronic
1168502680 19:56906585-56906607 GCAAAGCTTTGTAAGGAGAAGGG - Intergenic
927045169 2:19270986-19271008 TCTTTTCTCTATAAGAAGAAAGG + Intergenic
928900947 2:36316910-36316932 TCTGATCTTTGGAAGAAGACTGG + Intergenic
929857330 2:45648259-45648281 CCTTAATTTTGAAAGGAGAAAGG + Intergenic
930605721 2:53491033-53491055 TTTTGTCTTTGTAAGGAAAATGG - Intergenic
930932281 2:56901266-56901288 TTTCATCTTCGTAAGGAGAGTGG + Intergenic
932645433 2:73495545-73495567 TCTTATTTTTGAAGGGAGGAAGG + Intronic
933948687 2:87309734-87309756 TCTTAGCCTTCTAAGTAGAAAGG + Intergenic
935065526 2:99643958-99643980 TGTTGCCTTTGCAAGGAGAAAGG - Intronic
935384666 2:102487752-102487774 TCTTTTCTTTGTCAGGAGATGGG + Intronic
936331511 2:111551862-111551884 TCTTAGCCTTCTAAGTAGAAAGG - Intergenic
936663842 2:114572159-114572181 TGTTATTTTTATAATGAGAAAGG - Intronic
936834682 2:116694299-116694321 TCTTATCTATGAAAGGGGAAGGG + Intergenic
937854814 2:126664627-126664649 TCTAATATTTGGGAGGAGAAGGG + Intronic
938688408 2:133763388-133763410 TCTTGTCCTTGTCAGGAGACAGG - Intergenic
939248718 2:139659732-139659754 TTTTTTTTTTTTAAGGAGAAAGG - Intergenic
940450560 2:153830648-153830670 GCTCATTTTTCTAAGGAGAAAGG + Intergenic
940881867 2:158954773-158954795 TCTTTTTTTTTTAAGGAGACAGG + Intergenic
941029496 2:160494105-160494127 TTTTATCTTCGTAAGGGGGAGGG + Intergenic
941352644 2:164455375-164455397 TCTTATCTTTTCATGGAGACAGG - Intergenic
941562275 2:167061664-167061686 TGGTATCTTTATAAGAAGAAAGG + Intronic
941600869 2:167542802-167542824 TTTTTTTTTTGTAAGAAGAAAGG + Intergenic
941706144 2:168660223-168660245 TCTTATATTTGAAAGGTTAAGGG - Intronic
942624598 2:177886342-177886364 TATTAATTTTGTCAGGAGAAAGG + Intronic
942901110 2:181120031-181120053 TCTTATTTTTCTAAATAGAATGG - Intergenic
943264889 2:185716622-185716644 TCTTATCTTTGTATTCAGAATGG + Intergenic
943333334 2:186586506-186586528 TCTTATCTATGAAAGGGAAAGGG - Intergenic
944483018 2:200176468-200176490 TATTATTTTTAAAAGGAGAAAGG + Intergenic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
944714035 2:202361282-202361304 TCTTATTTTTGTCAGGGCAAAGG - Intergenic
945844198 2:214924247-214924269 TTTTATCTGTGTTAGGAGATAGG + Intergenic
946539684 2:220670568-220670590 TCAAATCTTTGGAAGCAGAACGG + Intergenic
947467030 2:230360544-230360566 TGTTATGTTTGTAAGCAGGATGG + Intronic
947475638 2:230445690-230445712 TGTTATGTTTGTAAGCAGGATGG + Intronic
948515563 2:238501313-238501335 TCTTATCTTTAAAATTAGAAGGG + Intergenic
1170435888 20:16328268-16328290 TCTCAGCTTTGTGGGGAGAAGGG + Intronic
1172259243 20:33547945-33547967 TCTTTTCTTTTTGTGGAGAATGG + Intronic
1172321845 20:34000976-34000998 ATTTATCTCTGGAAGGAGAAAGG + Intronic
1173446556 20:43124057-43124079 TCTTTTCTAATTAAGGAGAAAGG + Intronic
1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG + Intronic
1174110113 20:48193159-48193181 TCTTTTCTCTGTAAAGAGAGGGG + Intergenic
1174957152 20:55110804-55110826 TTTTTTTATTGTAAGGAGAATGG + Intergenic
1175334781 20:58188152-58188174 TATTATCTTAAAAAGGAGAAGGG + Intergenic
1176231196 20:64033946-64033968 CCTTAGCTGTGTAAGGATAAAGG + Intronic
1177323881 21:19557914-19557936 TCTTGTCTTTTTAAGGTGATAGG - Intergenic
1182409877 22:30175341-30175363 TTTTTTCTTTGGAAGGAAAATGG - Intronic
1182649995 22:31843918-31843940 TTTTTTCTTTGTAAAGAGACAGG + Intronic
949568079 3:5263896-5263918 TCTTAGGTTTGTTAGGAGAAGGG + Intergenic
949593617 3:5520045-5520067 CTTTATTTTTTTAAGGAGAATGG + Intergenic
949764507 3:7511358-7511380 GTTTATCTTTGAAGGGAGAAGGG - Intronic
950352767 3:12373380-12373402 TCTTATTTTTCTAAGTTGAAAGG - Intronic
950364246 3:12471817-12471839 TCTTATCTGTGAAAGGAAAGGGG + Intergenic
951838995 3:27013351-27013373 TCTTGTCTTTGTATGAAAAAGGG + Intergenic
951881236 3:27483620-27483642 TCTTCTCCTTCTAAGGAGGACGG - Intronic
953921164 3:46952810-46952832 TCTCATCTGTGGTAGGAGAAAGG - Intronic
955762907 3:62307664-62307686 TATTATCTTTGAAAAGATAAGGG + Intergenic
956684682 3:71814283-71814305 TCTCATGTTTGAAAGTAGAAAGG - Intergenic
957474717 3:80708526-80708548 TTTTGTTTTTGTAAGTAGAAGGG + Intergenic
958565738 3:95807400-95807422 TCCTATCTTTGTAAGGCGAGAGG - Intergenic
958687738 3:97422035-97422057 TATTTTCCTTGTAAGGAGAAAGG - Intronic
958731900 3:97968780-97968802 TCTTAACCTTGTCAGGAGATAGG - Intronic
958907839 3:99961469-99961491 TCTTAACTTTGCAAGGAGACAGG + Intronic
959302515 3:104621082-104621104 TATTATCTTTCTTATGAGAAAGG + Intergenic
960607070 3:119517468-119517490 TTTAATCTATTTAAGGAGAATGG + Intronic
960816973 3:121683816-121683838 TCTTCTCTTTCTAAGGCTAATGG - Intronic
961121132 3:124371564-124371586 CCTTATTTTTGTAAGAAGAAAGG - Intronic
961211547 3:125129588-125129610 TCATATCTCTGTCAGGAGGATGG + Intronic
963143678 3:141970278-141970300 TCATATCTTTGTAGGGGGCAGGG + Intronic
964616808 3:158674707-158674729 TCTTTTCTTTTCAAGGAGAGAGG - Intronic
967242483 3:187454493-187454515 TGTTAATTTTGGAAGGAGAAGGG + Intergenic
969213119 4:5702694-5702716 TTCTCTCTTTGTAAGAAGAAGGG + Intronic
969685970 4:8674492-8674514 TCTTTTCTTTCTGACGAGAAAGG - Intergenic
970086889 4:12358914-12358936 TTGTAACTTGGTAAGGAGAAGGG - Intergenic
970552486 4:17196753-17196775 TAATATTTTTGTATGGAGAAAGG - Intergenic
971206818 4:24578735-24578757 TCTTATTTTTGTAGAGATAAGGG + Intronic
971526868 4:27630578-27630600 TCTTATCCTTATAAGAATAAGGG - Intergenic
972860269 4:43160020-43160042 TCTTAACTTTAGAAGAAGAAAGG - Intergenic
973062292 4:45742503-45742525 TCTTAGCTCTGGAAGTAGAAAGG - Intergenic
973990408 4:56400517-56400539 TGTTATCTTTTTAAAAAGAAGGG + Intronic
974060902 4:57034431-57034453 TATTACCTTTGTAATTAGAAAGG + Intronic
975001458 4:69227599-69227621 AGATATCTTTATAAGGAGAAAGG - Intergenic
975012344 4:69373076-69373098 AGATATCTTTATAAGGAGAAAGG + Intronic
976087826 4:81424381-81424403 TCTTGTCTTTGTTAGATGAAAGG + Intergenic
976088815 4:81434053-81434075 TCTTATTTTATTAAGGAGACAGG + Intronic
977759965 4:100722162-100722184 TCTTTTTTTTGCAAGGGGAAAGG + Intronic
977864980 4:102014349-102014371 GGTTTTCTTGGTAAGGAGAATGG - Intronic
977936511 4:102811844-102811866 TTTTTTCTTTTTATGGAGAATGG - Intronic
978190998 4:105912130-105912152 TCTTTTCTCTGTAAGGAGGCTGG - Intronic
978369511 4:108016370-108016392 TCTTCTCTTTGTCAGGGGCAGGG - Intronic
978467351 4:109022392-109022414 TCTTCTCTTTGTGATGATAATGG - Intronic
980103421 4:128564467-128564489 TCATAGCTTTGCAGGGAGAATGG + Intergenic
980756181 4:137165251-137165273 TCATAACATTGCAAGGAGAAGGG - Intergenic
983263285 4:165480186-165480208 TCTAATCTTTTTAAGAACAATGG - Intronic
984445572 4:179831550-179831572 TCTTATCTCAGTAAGAAAAAAGG - Intergenic
985263940 4:188140551-188140573 TCTTTTGCGTGTAAGGAGAAAGG + Exonic
985384377 4:189429981-189430003 CGTTATCTTTGTTAGAAGAATGG - Intergenic
985521784 5:377282-377304 TCTTATCTTGTTTAGGAAAATGG - Intronic
986082238 5:4407274-4407296 TTTTCTCTTTGGAAAGAGAAAGG + Intergenic
986844449 5:11736332-11736354 TGTTATTGCTGTAAGGAGAAAGG - Intronic
987734864 5:21827523-21827545 TGTGAGCTTTGTAAGAAGAAAGG - Intronic
988372833 5:30393600-30393622 AATTATCCCTGTAAGGAGAAGGG - Intergenic
989090859 5:37729316-37729338 TCCTAGCTTTGTCAGCAGAAAGG - Intronic
989431850 5:41364677-41364699 TCTCAATTTTGTAATGAGAAAGG - Intronic
989556056 5:42796310-42796332 TCTTTTATTTTTAACGAGAAAGG - Intronic
990177745 5:53126717-53126739 TCTTGCCTTGGTGAGGAGAAAGG - Intergenic
990518842 5:56557733-56557755 TTTTATCTTTCTAGGGAGCAGGG + Intronic
990738976 5:58893143-58893165 TCTTATTATTTTAAGGAAAAAGG + Intergenic
991006850 5:61836434-61836456 TCTCATCTTTAAAATGAGAAAGG + Intergenic
991252813 5:64582554-64582576 TCTTATCTTTGGGAGAGGAAGGG - Intronic
992410650 5:76502135-76502157 GCTTATCTTTGGAAAGAGAGGGG + Intronic
994462904 5:100089690-100089712 TCAAATCATTGAAAGGAGAAAGG - Intergenic
995171061 5:109112680-109112702 TCTTGTCTTTATGAGGAGAGAGG + Intronic
995599860 5:113783627-113783649 TCTGATTTTTTTAAAGAGAAGGG - Intergenic
995945545 5:117640679-117640701 TCTTTTCTGGGGAAGGAGAAAGG + Intergenic
996214519 5:120850501-120850523 TCTTTTATTTGGGAGGAGAAAGG - Intergenic
997423425 5:133786898-133786920 TCTTATCTGTGAAATGAGAATGG - Intergenic
997919468 5:137964782-137964804 TCTCATATTTGTGATGAGAAAGG - Intronic
999900534 5:156081722-156081744 TCTTTTCTCTGTAAGGGCAAAGG + Intronic
1000490044 5:161901425-161901447 CATTATTTTTGTAAGGAAAATGG - Intergenic
1000538334 5:162507212-162507234 TCTTCTCTTGGTAAAGACAATGG + Intergenic
1000922789 5:167158683-167158705 TTGTATCCTTGTAAGGAGACAGG - Intergenic
1002281568 5:178133170-178133192 TCTAATCTTTGTCAGGCAAAAGG + Intronic
1003763657 6:9211110-9211132 TCTGATCTTTTTCAGGAGCAAGG - Intergenic
1004284745 6:14310832-14310854 TCTTATTTTTGTAAGGCAAATGG - Intergenic
1004372049 6:15061149-15061171 TCATATCTATGTAATGGGAATGG - Intergenic
1004518742 6:16342684-16342706 TCATTCCTTTGTAAGGAGAGGGG - Intronic
1004821145 6:19369106-19369128 TCTTCTCCTTATAAAGAGAATGG + Intergenic
1005598536 6:27403239-27403261 TATTATCTTTGAGAAGAGAAAGG - Exonic
1007043130 6:38743926-38743948 GCTTAACTTTTTAAGGAAAATGG + Intronic
1007604734 6:43109210-43109232 TCTTATTTTTTTAAAGAGATAGG + Intronic
1008064422 6:47032162-47032184 TTTTATTTTTTTAAGGAGGAGGG - Intronic
1008550554 6:52625672-52625694 TGTTAGCTTTTTAAGGACAATGG - Intergenic
1009714367 6:67369437-67369459 TCTTATTTTTCTAAGGATAATGG + Intergenic
1009907209 6:69884736-69884758 TCTAATTTTTGGAAGGAGAAGGG + Intronic
1010348515 6:74842031-74842053 TCTTATGTTTCTAAAGAGAAAGG + Intergenic
1010690111 6:78900717-78900739 TCTTTCATTTGTAAGGACAAAGG - Exonic
1011232784 6:85181528-85181550 TCTTATCTTTTTGATGATAATGG - Intergenic
1011330500 6:86199982-86200004 TTATATCTTTGAAAGAAGAAAGG - Intergenic
1011943038 6:92866625-92866647 TTTTATCCATGTAAGAAGAATGG - Intergenic
1012073079 6:94647894-94647916 TGGTATCTTTGTAAGAAGAGAGG - Intergenic
1012347017 6:98201828-98201850 TCTTTTATTTGTCAGGAGAAAGG - Intergenic
1013545588 6:111153810-111153832 TCTTATCTTTGTAAGGAGAAAGG - Intronic
1015773326 6:136791073-136791095 TGTTATCTTTGTAAGGATTTTGG - Intronic
1016065765 6:139681817-139681839 TCTTATTTTTCTATGTAGAAAGG - Intergenic
1017780876 6:157714307-157714329 TATTATCTTTGGAATGACAATGG + Intronic
1018575488 6:165255588-165255610 TCTTATATGTGTCAGGGGAAGGG - Intergenic
1019682476 7:2359045-2359067 TTTTTTCTTTGTAAAGAGACAGG - Intronic
1020250411 7:6463735-6463757 TTTTATCTTTTTAAAGAGACAGG - Intronic
1020499953 7:8905245-8905267 TGTTATTTTAGTATGGAGAAAGG + Intergenic
1021397705 7:20171016-20171038 TGTTATTTTTGTAAACAGAACGG + Intronic
1021775823 7:24054502-24054524 TCTTTTCTCTGTAAGAAGGAAGG + Intergenic
1022623229 7:32006600-32006622 TCTTATCCTTCTAAGGGAAATGG - Intronic
1024742695 7:52372212-52372234 TCTTATTTCTGTGGGGAGAATGG + Intergenic
1025225332 7:57154834-57154856 TGGTATCTCTGTAAGGAGACAGG + Intergenic
1025753743 7:64314538-64314560 TTTTATTTTTAAAAGGAGAAAGG - Intronic
1025832734 7:65067749-65067771 TCCTTTCTTTTTATGGAGAATGG + Intergenic
1025902506 7:65757277-65757299 TCCTTTCTTTTTATGGAGAATGG + Intergenic
1026428469 7:70320289-70320311 TCTTACCTTTGTGTTGAGAAGGG + Intronic
1027438922 7:78197300-78197322 TCTTATATTTGAAAACAGAAGGG - Intronic
1027672022 7:81112859-81112881 TGTTATCTTTGTAAAGGGCAGGG - Intergenic
1027886444 7:83912891-83912913 TCCTATTTCTGTAAGCAGAATGG + Intergenic
1030351634 7:108495414-108495436 TCTGAATTTTGTAAAGAGAATGG + Intronic
1030931347 7:115526536-115526558 TCCTGTCTTTGTCAGGAGGAGGG - Intergenic
1031065773 7:117104133-117104155 GCTAATTTTTGTAAGAAGAAAGG + Intronic
1032068032 7:128786896-128786918 TGTTATCTTTGTAGGCAGACAGG - Intergenic
1033041190 7:137919753-137919775 TCTTTTCTTTGTAATTAAAAAGG - Intronic
1033446948 7:141431523-141431545 TCTAATTTTTGAAATGAGAAAGG - Intronic
1033741647 7:144280599-144280621 TCTCATGTTTGTGAGAAGAAAGG - Intergenic
1033752254 7:144369015-144369037 TCTCATGTTTGTGAGAAGAAAGG + Intronic
1033873436 7:145785273-145785295 TCTCCTCTTTGTAAGGATACCGG - Intergenic
1036009174 8:4701676-4701698 ACTTTTTTTTTTAAGGAGAAAGG - Intronic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1037593923 8:20337931-20337953 TTTTATCTTTTTAAAGAAAAAGG - Intergenic
1039203854 8:35127659-35127681 GCTTATATTTGTAAGGACACAGG + Intergenic
1040938657 8:52809444-52809466 TCTTATTTTTGTATAGAGACAGG - Intergenic
1041540718 8:58981944-58981966 TGTTTTGTTTGTAAGGATAAAGG - Intronic
1042016177 8:64315445-64315467 TCTTATTTGTGTTAGGAGAAGGG - Intergenic
1042214748 8:66419051-66419073 TCATATATTTGATAGGAGAAGGG + Intergenic
1042514770 8:69647592-69647614 TATTTTTTTTGTAAGGTGAAAGG - Intronic
1043521543 8:81051565-81051587 TCTCATCATTCTAATGAGAAAGG - Intronic
1043641698 8:82459678-82459700 TTTTATTTTTGTTAGGATAAAGG - Intergenic
1043753722 8:83974618-83974640 TCTTATTTCTGGAAGCAGAAAGG + Intergenic
1045780783 8:105860915-105860937 TCTTATATTTGTAACTATAATGG + Intergenic
1046659380 8:116932672-116932694 TCTTATTTTTTTAAAGAGATGGG + Intergenic
1047067023 8:121296378-121296400 TCTTATCATTCTAATGACAATGG - Intergenic
1048473708 8:134724792-134724814 TCTTGACTCTGTAAGGGGAAGGG - Intergenic
1048638102 8:136322047-136322069 TCTTTTCTCTGCAAGAAGAATGG - Intergenic
1048765350 8:137837681-137837703 TCTCATCTTGATAAGAAGAAAGG + Intergenic
1048929356 8:139298831-139298853 TGTTATTTTGCTAAGGAGAATGG + Intergenic
1049581655 8:143414343-143414365 TCTTTTTTTTTTAAGGATAAAGG + Intergenic
1050967145 9:11819816-11819838 ACTTTTCTTTGTAAGAAGATAGG + Intergenic
1051100926 9:13520549-13520571 TCTTAAATTTGTGAGGAAAATGG - Intergenic
1055563494 9:77545357-77545379 TCTTAGCTTTCCAAGGTGAACGG - Intronic
1055644954 9:78354678-78354700 TCTTATTTTTATTAGGAGACAGG + Intergenic
1056392175 9:86150546-86150568 ATTTATCTTTTTAAGGAGGAAGG + Intergenic
1058621462 9:106887906-106887928 GCTTGTCTTTGGAAGTAGAAAGG - Intronic
1058883266 9:109303673-109303695 TCTTTTCTTTTTGTGGAGAAGGG + Intronic
1059409161 9:114121417-114121439 TATTATCTTTTTCAGGAGACGGG - Intergenic
1059602042 9:115789383-115789405 TATTTTCCTTGTAAGAAGAAAGG + Intergenic
1059734800 9:117090453-117090475 TTGGCTCTTTGTAAGGAGAATGG - Intronic
1059957392 9:119532530-119532552 TTTTCTCTTTCTAAGCAGAAGGG - Intergenic
1061702451 9:132426173-132426195 TTTTATTTGTGTCAGGAGAAAGG + Intronic
1062155021 9:135042977-135042999 TCTTATCTTTGTAAACACTAGGG + Intergenic
1185768041 X:2741897-2741919 TCTTAACTTCTTAAGGAGAGAGG - Intergenic
1187407787 X:19019556-19019578 TTTTTTTTTTTTAAGGAGAAGGG + Intronic
1188027875 X:25230056-25230078 TATTATCTGTGTAAAGAGAAAGG - Intergenic
1188275825 X:28199216-28199238 TCTCATATTAGTCAGGAGAAAGG + Intergenic
1188295434 X:28441757-28441779 TCTCATCTTTAAAACGAGAATGG - Intergenic
1188630032 X:32344618-32344640 TCACATCTTTGCCAGGAGAAAGG + Intronic
1189239008 X:39511428-39511450 TCTTAACTTTCTGAGCAGAATGG - Intergenic
1189648699 X:43164453-43164475 GCTTATCTCTGTAGAGAGAAAGG - Intergenic
1190445908 X:50523866-50523888 TCTTATCTTTACAAGAATAAAGG + Intergenic
1192543906 X:71997022-71997044 TCTGATCCTTGGAATGAGAAAGG - Intergenic
1194044180 X:88981962-88981984 TTTTATTTTTGTAATCAGAATGG - Intergenic
1196847823 X:119910582-119910604 TTTCATCTTTTGAAGGAGAAAGG - Intronic
1197133293 X:123030978-123031000 GCTTATGTTTGTAAGCAGAAGGG - Intergenic
1197760266 X:130023104-130023126 TCTTATCTCTGCAAGGAGCTGGG - Intronic
1198168026 X:134076873-134076895 TATTCTCTTGGAAAGGAGAATGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199058133 X:143321472-143321494 TCTTATCTATCAAAGGAGGAGGG + Intergenic
1199430590 X:147755179-147755201 TCTGATCTCTCTATGGAGAAAGG - Intergenic
1199654301 X:149979651-149979673 TTTTATTATTGTAAAGAGAAGGG - Intergenic
1199654344 X:149980030-149980052 TTTTATTATTGTAAAGAGAAAGG - Intergenic