ID: 1013547785

View in Genome Browser
Species Human (GRCh38)
Location 6:111176168-111176190
Sequence GTGGATTAGTAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013547777_1013547785 20 Left 1013547777 6:111176125-111176147 CCTAGAAGTGATTCTTGAGCCTG 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG No data
1013547780_1013547785 1 Left 1013547780 6:111176144-111176166 CCTGATTTGAAGGTGGTGCTAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013547785 Original CRISPR GTGGATTAGTAGAGGGAGAA GGG Intronic
No off target data available for this crispr