ID: 1013548448

View in Genome Browser
Species Human (GRCh38)
Location 6:111183178-111183200
Sequence TGGCAGAAGCAGAGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 0, 2: 18, 3: 139, 4: 715}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013548448_1013548452 -7 Left 1013548448 6:111183178-111183200 CCTTGCCCACTCTGCTTCTGCCA 0: 1
1: 0
2: 18
3: 139
4: 715
Right 1013548452 6:111183194-111183216 TCTGCCATTCGCCTTTTAATGGG 0: 1
1: 0
2: 0
3: 7
4: 110
1013548448_1013548451 -8 Left 1013548448 6:111183178-111183200 CCTTGCCCACTCTGCTTCTGCCA 0: 1
1: 0
2: 18
3: 139
4: 715
Right 1013548451 6:111183193-111183215 TTCTGCCATTCGCCTTTTAATGG No data
1013548448_1013548453 -6 Left 1013548448 6:111183178-111183200 CCTTGCCCACTCTGCTTCTGCCA 0: 1
1: 0
2: 18
3: 139
4: 715
Right 1013548453 6:111183195-111183217 CTGCCATTCGCCTTTTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013548448 Original CRISPR TGGCAGAAGCAGAGTGGGCA AGG (reversed) Intronic
900341122 1:2189854-2189876 CGGCAGGAGCAGAGAGGGCCCGG - Intronic
900989596 1:6092268-6092290 GGGCAGAAGCAGGCTGGACAGGG - Intronic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
901444856 1:9301939-9301961 TGGCAGAAGCACTGTGTGCAGGG - Intronic
901917093 1:12508175-12508197 GGGCAGAAGTATAGTGGGCGAGG - Intronic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902284036 1:15394837-15394859 TTGCAGGAACAGAGTTGGCAAGG + Intronic
902560648 1:17275144-17275166 TAACAGAAGAAGAGTGGGCATGG + Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903175422 1:21577552-21577574 TGGCAGGAGCACAGTGGCCGAGG - Exonic
903293503 1:22329298-22329320 TGGCTGGAGTAGAGTGGGCAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903905536 1:26683353-26683375 AGGAAGAAGCAGGCTGGGCATGG - Intergenic
904270700 1:29348118-29348140 AGGCAGGAGCAGAGAAGGCAGGG - Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
905270300 1:36783222-36783244 GGGCAAAAGCTGAGTGAGCAAGG + Intergenic
905862038 1:41358287-41358309 TGGCAGCAGCAGTGGTGGCAGGG + Intergenic
906248751 1:44295204-44295226 TGGGAGAGGAAGAATGGGCAGGG + Intronic
906263012 1:44407333-44407355 TGGGGGGAGCAGAGTGGGCAGGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907601974 1:55781087-55781109 TGGCAGAAGCATTGTGTTCAGGG + Intergenic
908121686 1:60991803-60991825 TGGCTGGAGGAGACTGGGCAAGG - Intronic
908386163 1:63643780-63643802 TGGTAGAAGCACAGAGGGCATGG + Intronic
908535749 1:65075399-65075421 TGGCAGAATTAAAGTGGTCAGGG + Intergenic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
909034432 1:70581133-70581155 TGGTAGAAGCACAGTGGGCAGGG - Intergenic
909340315 1:74524320-74524342 TGCCAGAAACAGAGGGGGCTTGG + Intronic
909781368 1:79551420-79551442 TGGCAGAAGCATTGTATGCAAGG - Intergenic
910002173 1:82354242-82354264 TGGCTATAGCAGAGTGGGCAAGG - Intergenic
910670182 1:89764334-89764356 TGGAAGAAACAGAGTGAACAAGG - Intronic
910969721 1:92844085-92844107 TGGGAGAAGCAAAGTCGGCATGG - Exonic
911642453 1:100303629-100303651 TGGCAGAAGCATTGCGGTCAGGG - Intergenic
912045130 1:105444273-105444295 TGACAGAAACATAGTGTGCAAGG - Intergenic
912552309 1:110492214-110492236 TGGGTGAAGCAGAGGGGACAAGG - Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913660369 1:121001684-121001706 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
914011734 1:143784841-143784863 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
914166099 1:145176293-145176315 TGGCAGAGAAAGGGTGGGCATGG + Intergenic
914650360 1:149693500-149693522 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
915552761 1:156644740-156644762 AGGCAGATGCTGAGAGGGCAGGG + Intronic
915774886 1:158472179-158472201 TGTCAGAAGCAATGTGGTCATGG + Intergenic
916271858 1:162952029-162952051 TGGAAGAACCAGAGTGGTAAAGG + Intergenic
916273797 1:162971922-162971944 TGGCAGATGGAGAGGGGTCAGGG + Intergenic
916292732 1:163184455-163184477 TGACAGAAGAAGAGTTAGCAAGG + Intronic
916990467 1:170238099-170238121 GGGCAGGAGCACAGTGGGCCGGG + Intergenic
917829654 1:178866929-178866951 TAGCAGAAGTAGAATGGGTAAGG + Intronic
917926753 1:179795514-179795536 TGGCAGAAGGTGAGTGAGCAAGG - Intronic
918136720 1:181680552-181680574 TGTGAGAAGCAGGGTGGGCTGGG - Intronic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
919921303 1:202168100-202168122 TGGCAGAGGTAAGGTGGGCATGG + Intergenic
919928038 1:202202813-202202835 TGGCAGAAGCAGAGGGTGAGAGG - Intronic
920713108 1:208314063-208314085 TGGCAGAAGGAGGGTGGTGATGG + Intergenic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922054371 1:222026393-222026415 TGGAAGAAGCACAGTGGGAGAGG - Intergenic
922927330 1:229360835-229360857 TGGCGGGAGCAGGGTGGGGAGGG + Intergenic
922985398 1:229862369-229862391 AGGCAAAGGCAGAGTGGGAAGGG + Intergenic
923385259 1:233459836-233459858 GGTCAGAGGCAGAGGGGGCAGGG - Intergenic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
924428402 1:243974768-243974790 TAGGAGAAGAGGAGTGGGCAGGG - Intergenic
1063162987 10:3433355-3433377 TGGCAGAAGCAGGGAGGAAACGG + Intergenic
1063442942 10:6088531-6088553 TGACAGAAGCAGGGAGGGAAAGG - Intergenic
1063875964 10:10478985-10479007 TGCCAGGAGAAGAGTGGGGATGG - Intergenic
1064300104 10:14115728-14115750 TGGAAGATGGAGAGGGGGCAGGG - Intronic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065925515 10:30431809-30431831 CGGCAGAAGCAGCCTGGGCCGGG - Intergenic
1067204640 10:44202380-44202402 TGGTAGAAGGAAAGTGGGCATGG - Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067525878 10:47038270-47038292 TGACCGCAGGAGAGTGGGCAAGG + Intergenic
1067832537 10:49618535-49618557 AGAAAGAAGCAGAGTGGACATGG + Intronic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1068532505 10:58205669-58205691 TGGAAGGAGAAGAGTGGGAAGGG + Intronic
1068545023 10:58335267-58335289 TGGCCGAGTCAGCGTGGGCAGGG - Intronic
1069009735 10:63358693-63358715 TGGCAGTAGAAGAGTGGGGTGGG + Intronic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069184888 10:65410255-65410277 TGGTAGAAGCATTGTGTGCAGGG - Intergenic
1069723305 10:70562796-70562818 TGGAAGGAGCAGGGTGGGCAGGG + Intronic
1070173813 10:73953625-73953647 AGGCAGAAGCACAGTGGACATGG + Intergenic
1070289105 10:75103391-75103413 AGGCAGAAGCAGTGTGTCCAGGG + Intronic
1070673419 10:78394322-78394344 TGGGAGTAGCACAGTGGCCAGGG - Intergenic
1070706045 10:78639531-78639553 TGGCAGAAGCACTGAGTGCAGGG + Intergenic
1070977265 10:80615053-80615075 AGGCAGCAGCTGAGTGGGAATGG + Intronic
1072171009 10:92861636-92861658 TGGCAGTAGCTGAGAAGGCAGGG - Intronic
1072220251 10:93321012-93321034 TAGCAGGGGCAGAGTGGGAATGG + Intronic
1072310632 10:94150904-94150926 TGGCAGCAGTCTAGTGGGCATGG + Intronic
1072517722 10:96202307-96202329 TGGCAACAGCAGAGTGGGGGAGG + Intronic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1072819108 10:98538627-98538649 CAGCAAAAGCAGAGTTGGCAGGG - Intronic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073464684 10:103687551-103687573 TGGCAGCAGTGGAGGGGGCAAGG - Intronic
1074632374 10:115272951-115272973 TGGCAGAAGCATTGTGAGCGAGG + Intronic
1075320514 10:121487959-121487981 TGGCAGTAACACAGTGGGCAGGG - Intronic
1075763999 10:124878565-124878587 TGGAAGAAGCCAAGTGGGAAGGG - Intergenic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1075930436 10:126290349-126290371 GGTCAGAAGCCCAGTGGGCATGG - Intronic
1076145671 10:128118105-128118127 TGGCAGAAATGGACTGGGCATGG + Intronic
1077032436 11:474537-474559 TGGCTGAGGCAGAGTGCGCTGGG - Intronic
1077169819 11:1161107-1161129 TGGCAGAGGCAGGGCAGGCAAGG + Intronic
1077200108 11:1302510-1302532 AGCCAGCAGCTGAGTGGGCATGG - Intronic
1077317962 11:1927662-1927684 GGGCAGGAGCAGAGGAGGCAGGG + Intronic
1077389670 11:2294395-2294417 CGGCAAAAGCACCGTGGGCAAGG + Intergenic
1078359285 11:10655962-10655984 GGGCAGGAGCAGCGTGGGAATGG - Intronic
1078865249 11:15291255-15291277 TGGCAGCAGGAGGGTGAGCAGGG + Intergenic
1079460784 11:20676073-20676095 TGGCAGAAACTGAATGGGCCAGG - Intronic
1080157641 11:29130693-29130715 TGACTGTAGCAGAGTGGACAGGG + Intergenic
1080820270 11:35799211-35799233 TGGCAGAACCTGTGTGGGGATGG - Intronic
1080849942 11:36059510-36059532 GGGCTGAAGCAGAGTGCCCAGGG - Intronic
1081065303 11:38533642-38533664 TGGCAGGAGCATTGTGTGCAGGG + Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081570212 11:44286127-44286149 TGACACAAGCAGTGTGTGCAGGG - Intronic
1082808055 11:57462357-57462379 GGGCAGATGCTGAGGGGGCAGGG - Intronic
1082999814 11:59280972-59280994 TGGCAGAAGCATTGTGTGCAAGG - Intergenic
1083001641 11:59297720-59297742 TGCCTGCAGCAGAGTGGGAAAGG + Intergenic
1083172288 11:60930194-60930216 TAGCTGAAGCAGAGAGTGCATGG + Intronic
1083417601 11:62535768-62535790 TGACAGACACAGAGTGGCCAAGG + Intronic
1083443900 11:62694505-62694527 TGGCAGGATCAGAATGGGTAGGG - Intronic
1083751461 11:64763173-64763195 TGGCAGAATCAGAGAGAGAAAGG - Intergenic
1083855904 11:65392986-65393008 TGGCAGGAGCAGAGTGGGAGAGG + Intronic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1084179237 11:67438315-67438337 TGGCAGAAGCTGAGTGGGAAGGG + Exonic
1084179839 11:67440766-67440788 ATGCAGAAGCAGAGAGGGCTGGG + Intronic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1084299626 11:68239024-68239046 TGGCAGAAGAAGGCTGGGCGTGG + Intergenic
1084414201 11:69021480-69021502 TGGCAGAAGCACTGTAGGCAAGG + Intergenic
1084430519 11:69108255-69108277 TGGCAGGCTCACAGTGGGCAGGG - Intergenic
1084459222 11:69286922-69286944 AGGCGCAAGCAGGGTGGGCACGG - Intergenic
1084792510 11:71483487-71483509 TGGAAGAGGCAGTGAGGGCAGGG - Intronic
1085021448 11:73212694-73212716 TGGCAGGAGTTGAGTGTGCAGGG - Intergenic
1085255554 11:75170720-75170742 TTCCAGAAGGAGAGTGGGCGGGG - Intronic
1085300929 11:75457788-75457810 TGCCAGGAGGAGAGGGGGCAGGG + Intronic
1085355451 11:75832527-75832549 TGGCACACCCAGAGAGGGCATGG - Intronic
1085448342 11:76615904-76615926 GGGCTGAAGCAGGGTGGGGATGG + Intergenic
1086174937 11:83880071-83880093 TGGCCAGAGCAGAGTGGCCAGGG + Intronic
1086182713 11:83973613-83973635 TGGTAGCAGCAGAATGGGCTAGG + Intronic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088926409 11:114307657-114307679 TGGCAGAGCCAGACTAGGCAGGG - Intronic
1089218738 11:116852973-116852995 TGGAGGGTGCAGAGTGGGCAAGG + Intronic
1089395296 11:118132638-118132660 TGGAGGAAGCAGAGCTGGCAGGG + Intergenic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1089639040 11:119834933-119834955 TGGCAGACTCTCAGTGGGCAAGG + Intergenic
1089869413 11:121658864-121658886 TGGCAGAGGCAAAGTGAACATGG + Intergenic
1090206157 11:124885504-124885526 TGGCAGAAGAAGAATGCCCAGGG - Intronic
1090753863 11:129771514-129771536 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1091068006 11:132535426-132535448 AGGCAGAAGAAAAGTGGGCCTGG + Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091212566 11:133874635-133874657 TGGCAGAAGCATTGAGTGCAGGG - Intergenic
1091252669 11:134156600-134156622 TGGCAGTTGCAGAGCGTGCATGG + Intronic
1091585166 12:1811729-1811751 GGGCAGAAAGAGAGAGGGCAAGG + Intronic
1091637750 12:2210652-2210674 TGGCAGAATCTGAGAGGACAGGG + Intronic
1092058141 12:5523875-5523897 TGGCAGGGGCAGAGAAGGCAGGG + Intergenic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092126323 12:6077462-6077484 CGGCAGAAGGGGATTGGGCAAGG - Intronic
1092155113 12:6277124-6277146 TGGCAGGAGCAGAGCAAGCAAGG + Intergenic
1092285153 12:7124442-7124464 AGGAAGAAACAGAGTGGCCAAGG - Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1092922396 12:13244421-13244443 TGGCAGAAGCACTGTGTGCAGGG + Intergenic
1094100213 12:26753549-26753571 TGCCTGAAGCAGGGTGGGGAAGG - Intronic
1094765696 12:33592148-33592170 TGGCAGAAGGATAGAGAGCAAGG + Intergenic
1095138459 12:38635656-38635678 AGGCAGGAGCCTAGTGGGCAAGG - Intergenic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096235494 12:49923456-49923478 TGGCTGGAGCGGAGTGGCCAAGG + Intergenic
1096309251 12:50505476-50505498 GCGCAGAAGCAGTGTGGGCCCGG - Intronic
1096416799 12:51421581-51421603 TGGCAGAAGTGGAGTAGGTAGGG - Intronic
1096551177 12:52372780-52372802 TGGCAGAAGCAGAGAAGGCCAGG + Intergenic
1096782387 12:53998703-53998725 TGGGTGAAGAAGAGGGGGCATGG - Intronic
1097193270 12:57230386-57230408 GGGAAGAGGCAGAGTTGGCAAGG - Intronic
1097723029 12:63044365-63044387 TGGCTGGAGTGGAGTGGGCAAGG - Intergenic
1097753699 12:63385863-63385885 TGGCAGAAGCATTGTATGCAGGG + Intergenic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098391908 12:69978466-69978488 TGGCTGAAGAAGTGTGGCCAGGG + Intergenic
1100275070 12:93064287-93064309 AGGCTGAAGCCGAGTGGGCAAGG - Intergenic
1100501977 12:95183160-95183182 CAGCAGAAGCATAGTGGGAAGGG - Intronic
1101107603 12:101455624-101455646 TGGAATAAGCAGATTGGGAAAGG - Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101194097 12:102365063-102365085 TGGCAGAAGCAAGGTGGGGGAGG - Intergenic
1101542400 12:105676927-105676949 TGCCAGCAGCCCAGTGGGCAAGG + Intergenic
1101697219 12:107138133-107138155 TGGCAGAAGCACTGCAGGCAGGG + Intergenic
1102416639 12:112768413-112768435 TGGCTGGAGCAGAGAGGACAAGG - Intronic
1102473248 12:113172283-113172305 TGGCAGAAGCCGAGGGTACAAGG - Intronic
1103338890 12:120210725-120210747 TGGCAGAAGCCGAGTGTGCTGGG - Exonic
1103557734 12:121776170-121776192 CAGCAGAAGCAGAGTGGCCCCGG - Exonic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103767656 12:123293121-123293143 TTGCAGAGGCAAAGTGGACATGG + Exonic
1103952107 12:124556997-124557019 TGGCTGAGACAGAGCGGGCAAGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1104831935 12:131758244-131758266 TGGCAGCAGCCTTGTGGGCAGGG - Intronic
1104951364 12:132442067-132442089 TGGCAGGAGCAGGGAGGGCGTGG - Intergenic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1105665583 13:22552344-22552366 TGGCTGGAGCAGAGTGGGACAGG + Intergenic
1106286692 13:28324249-28324271 AGGCAGAAGCAGAGAGGGACTGG + Intronic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1107130230 13:36886905-36886927 TGGCCAAGGAAGAGTGGGCAAGG + Intronic
1107131394 13:36900094-36900116 TGGCAGGAGTAGAGAGAGCAAGG - Intronic
1107285135 13:38781966-38781988 GGGCAAAAGCAGAGTGGGCCAGG - Intronic
1107434806 13:40372911-40372933 TGGGAGGGGGAGAGTGGGCAGGG - Intergenic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108832335 13:54495616-54495638 TGGCACATGAAGAATGGGCAGGG + Intergenic
1109035566 13:57255862-57255884 TTGCAGCAGCAGAGTGCTCAAGG - Intergenic
1109297084 13:60547334-60547356 TGAGAGAAGGGGAGTGGGCAAGG + Intronic
1109933174 13:69244092-69244114 TGGCAGAAGCATTGTGTGCAAGG + Intergenic
1110248337 13:73353310-73353332 TGGCAGAAGCATTGTGTACAGGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112036441 13:95500925-95500947 TGGAAGAAGCAGAGAGGGCGCGG + Intronic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1112247496 13:97747909-97747931 TGGAAGAGGCACAGAGGGCATGG - Intergenic
1112590271 13:100757079-100757101 TGGCAGAAGCAGAAGGGGCTCGG + Intergenic
1112759458 13:102677529-102677551 TGGCAGAAGCAGAGTTTGTATGG - Intronic
1112783322 13:102925833-102925855 GGGCTGGAGCAGGGTGGGCAAGG + Intergenic
1112905507 13:104415108-104415130 TAGCAAAAGTAGTGTGGGCATGG + Intergenic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113361196 13:109633079-109633101 TGGCAGAAGGTAAGGGGGCAAGG - Intergenic
1113444435 13:110354888-110354910 CGGCAGTGGCAGAGTGGGCCTGG + Intronic
1113741434 13:112714718-112714740 TGCCAGAAGCCGAGGTGGCAAGG - Intronic
1114356828 14:21919112-21919134 TGGCAGAGCCAGAGAAGGCATGG - Intergenic
1114550237 14:23528581-23528603 TCACAGAGGCAGAGTGGGCAGGG - Intronic
1114652205 14:24292384-24292406 CAGTAGAAGCAGAGAGGGCAGGG - Intronic
1114811582 14:25906628-25906650 TGGCAATAGCACAGTGAGCAAGG + Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115829933 14:37326421-37326443 TGGCAGAAGCATTGTGTGTAGGG + Intronic
1116891726 14:50275438-50275460 TGGCAGAAGCATTATAGGCAGGG - Intronic
1116997556 14:51339688-51339710 TGGCCGGAGCAGAGTGGATAAGG - Intergenic
1117980131 14:61334619-61334641 TGGCAGAAAGAGAGTCGGCTTGG + Intronic
1118780955 14:69007246-69007268 TGGCAGCAGGAGACTGGGCTTGG + Intergenic
1119225269 14:72940400-72940422 TGGCAGGAGCGGAGAGGACAGGG - Intronic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119765485 14:77185019-77185041 ATGCAGAGGCAGAGTGGGCGGGG + Intronic
1120701623 14:87704860-87704882 TGGAAGAAGCAGAGTTGGCCTGG - Intergenic
1120703373 14:87723131-87723153 TGGCTGGAGAAGAGTGGGCAAGG + Intergenic
1121468908 14:94136765-94136787 TGGCAGAGACAGAGAGGACAGGG - Intergenic
1122203506 14:100136789-100136811 TGGAAGAAGCAAACAGGGCAGGG - Intronic
1122303895 14:100749264-100749286 TGGCAGAAGCATTGAGGGCAGGG - Intergenic
1122307572 14:100775668-100775690 CAGCAGGAGAAGAGTGGGCAGGG - Intergenic
1122314056 14:100815345-100815367 TGGCACACGCAGAGTCAGCATGG + Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1122957285 14:105076641-105076663 GGGGTGACGCAGAGTGGGCAAGG + Intergenic
1123100201 14:105792526-105792548 TGGTAGAAAGGGAGTGGGCAGGG + Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124647521 15:31449389-31449411 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1125469529 15:39989403-39989425 TGGTAGAAGCAGAATTTGCAAGG + Intronic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1126073782 15:44888567-44888589 TGGCAGAATCACAGTGAACAAGG + Intergenic
1126084407 15:44998287-44998309 TGGCAGAATCACAGTGAACAAGG - Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1126596899 15:50392127-50392149 TGGCACACGCAGAGAGGGCATGG + Intergenic
1126891977 15:53216141-53216163 TAGCAGGAGGAGAGTGGACAGGG - Intergenic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127605785 15:60586716-60586738 TGGCAGAAATATTGTGGGCAGGG + Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128077597 15:64837641-64837663 TGACAGAAGCTTAGTGAGCAAGG - Intergenic
1128111505 15:65079118-65079140 TGGCAAAAACAGGGTGGGCAAGG - Intergenic
1128325649 15:66722471-66722493 GGGGATAGGCAGAGTGGGCATGG - Intronic
1128393134 15:67196721-67196743 TGGCAGCAGCAGAGAGGTGATGG - Intergenic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128526894 15:68418680-68418702 AGCCAGAATCAGTGTGGGCAGGG - Intronic
1128616796 15:69116625-69116647 AGGCAGAAGCATAGTGGGTGGGG - Intergenic
1128795912 15:70466460-70466482 TGGCAGATGGAGCGTCGGCAGGG - Intergenic
1129009042 15:72398246-72398268 TGGCAGAAGCAAAAAGGGCCAGG - Intergenic
1129113462 15:73351843-73351865 TGTCTGCAGCAGAGTGTGCAAGG - Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1130059133 15:80557184-80557206 AGGAAGGAGCAGAGTGTGCAGGG - Intronic
1130644337 15:85710469-85710491 TGCAAAAAGCAGAGTGGGAAAGG + Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131663256 15:94541353-94541375 TGGAGGCAGCAGAGTGGCCATGG + Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131837473 15:96405571-96405593 TGGCAGATTCAGAGTGGCCAAGG - Intergenic
1131988740 15:98071398-98071420 TGGGAGAAGAAGAGTGGGAGTGG - Intergenic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1133676271 16:8075838-8075860 TGGCAGAAGCAGAGGGTGTGGGG - Intergenic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1134653068 16:15926013-15926035 TTGCAAATGAAGAGTGGGCAGGG - Intergenic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135522594 16:23188953-23188975 GGGCAGAGGCAGAGTGAGCTGGG + Intronic
1135722569 16:24829775-24829797 TGTCTGAGACAGAGTGGGCAAGG + Intergenic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1136289687 16:29264178-29264200 TGGCAGGAGCAAGGAGGGCAGGG - Intergenic
1136289696 16:29264209-29264231 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1136289705 16:29264240-29264262 TGGCAGGAGCACAGAGGGCAGGG - Intergenic
1136289713 16:29264271-29264293 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1136289722 16:29264302-29264324 TGGCAGGAGCAAGGAGGGCAGGG - Intergenic
1136368415 16:29820632-29820654 TGTCTGAATCAGAGTGGGGAAGG + Intronic
1136477341 16:30521713-30521735 AGGCAGAGGCAGAGTGGCCCTGG - Exonic
1136683960 16:31983426-31983448 TGGCAGATGCTGAGCAGGCATGG - Intergenic
1136784586 16:32926978-32927000 TGGCAGATGCTGAGCAGGCATGG - Intergenic
1136885197 16:33926828-33926850 TGGCAGATGCTGAGCAGGCATGG + Intergenic
1137010800 16:35317606-35317628 TGGCAGAAGCAGAGTGCCTCAGG + Intergenic
1137652593 16:50133374-50133396 TGGTAGAAGCATTGTGTGCAGGG + Intergenic
1138124841 16:54430244-54430266 TGGCAGAAGGAGAAAGGACAAGG + Intergenic
1138197209 16:55060496-55060518 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1138277439 16:55746041-55746063 AGGCAGAAGGAGAGAGGGCAGGG + Intergenic
1138339680 16:56280558-56280580 TGGCATGTGCAGAGTGGACAGGG + Intronic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139282822 16:65784810-65784832 AGGCAGAAGCAGAGTGGAAAGGG + Intergenic
1140278698 16:73534163-73534185 TGGCTGGAGCTGAATGGGCAAGG - Intergenic
1140735636 16:77895517-77895539 TGGCAGAAGCAGAGGAAGAAGGG + Intronic
1140851039 16:78934807-78934829 GAGAAGAAGCAGACTGGGCATGG + Intronic
1141153319 16:81579588-81579610 TGGAAGAGGTAGAGGGGGCATGG + Intronic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141888411 16:86909759-86909781 AGGCTGAAGCAGAGAGGGAAGGG - Intergenic
1142095424 16:88237158-88237180 TGGCAGGAGCAAGGAGGGCAGGG - Intergenic
1142095433 16:88237189-88237211 TGGCAGGAGCACAGAGGGCAGGG - Intergenic
1142095441 16:88237220-88237242 TGGCAGGAGCACAGAGGGCAGGG - Intergenic
1142095469 16:88237313-88237335 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095478 16:88237344-88237366 TGGCAGGAGCACAGAGGGCAGGG - Intergenic
1142095486 16:88237375-88237397 TGGCAGGAGCACAGAGGGCAGGG - Intergenic
1142095494 16:88237406-88237428 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095503 16:88237437-88237459 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095512 16:88237468-88237490 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095521 16:88237499-88237521 TGGCAGGAGCAAGGAGGGCAGGG - Intergenic
1142095530 16:88237530-88237552 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095539 16:88237561-88237583 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095548 16:88237592-88237614 TGGCAGGAGCACAGAGGGCAGGG - Intergenic
1142095556 16:88237623-88237645 TGGCAGGAGCAAGGAGGGCAGGG - Intergenic
1142095565 16:88237654-88237676 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095574 16:88237685-88237707 TGGCAGGAGCACAGAGGGCAGGG - Intergenic
1142095582 16:88237716-88237738 TGGCAGGAGCACGGAGGGCAGGG - Intergenic
1142095591 16:88237747-88237769 TGGCAGGAGCAAGGAGGGCAGGG - Intergenic
1142095610 16:88237809-88237831 TGGCAGGAGCACAGAGTGCAGGG - Intergenic
1142178868 16:88657624-88657646 GGGCAGGAGCAGGGCGGGCAGGG - Intronic
1203087245 16_KI270728v1_random:1190984-1191006 TGGCAGATGCTGAGCAGGCATGG - Intergenic
1143092555 17:4457663-4457685 TGGCAGAAGCAGGGCTGGCAGGG - Intronic
1143328671 17:6118490-6118512 GGGCAGAAGCAGAGATGGAAAGG - Intronic
1143341342 17:6213750-6213772 AAGCAGAAGAAGACTGGGCACGG - Intergenic
1143467667 17:7148727-7148749 TGGCAGGAGCACTGCGGGCAGGG - Intergenic
1143610923 17:8016917-8016939 TTGCAGGAGGGGAGTGGGCACGG - Intronic
1143611307 17:8019419-8019441 AGGTAGAAGTGGAGTGGGCAGGG + Intronic
1143685716 17:8514145-8514167 TGGCAGCAGGAGAATGTGCAGGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143942466 17:10556839-10556861 TGTCACAAGCTGAGTGGGCTTGG - Intergenic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144405496 17:14949072-14949094 TGGCAGGACCGGAGAGGGCATGG + Intergenic
1144517156 17:15926589-15926611 TGTGAGCAGCAGAATGGGCAAGG + Intergenic
1144782931 17:17816926-17816948 TGGCCCCGGCAGAGTGGGCAGGG - Intronic
1145000765 17:19302945-19302967 TGGGAGAAGCACATAGGGCAGGG + Intronic
1145028451 17:19486798-19486820 TGGCAGATGCAGAGGTGGAAGGG - Intergenic
1145121348 17:20263086-20263108 GGGCAGAGGCAGAGTGGACAGGG - Intronic
1145261877 17:21359344-21359366 TGGCAGAAAGAGAGTGTGCCTGG + Intergenic
1146164841 17:30579742-30579764 GGGCAGAGGCAGAATGGACAGGG - Intergenic
1146231601 17:31115789-31115811 TGGCAGAAGCACTGTAGGCAGGG + Intronic
1146281789 17:31549680-31549702 TGGCCGCAGCGGAGCGGGCAGGG - Intergenic
1146465132 17:33080188-33080210 GGGCCAAGGCAGAGTGGGCAGGG + Intronic
1146685105 17:34836326-34836348 TGGCAGGAGAAGAGAGGGCTTGG - Intergenic
1146825032 17:36014395-36014417 TGGAAGAAGCAGACAGGACAGGG + Intronic
1147039107 17:37703699-37703721 TGGCAGAAGGAAAATGGGAATGG - Intronic
1147365180 17:39954391-39954413 AGCTACAAGCAGAGTGGGCAGGG + Intergenic
1147629080 17:41918597-41918619 TGGCAGAGGCAGAAGAGGCAAGG + Intronic
1147632480 17:41941010-41941032 TGGCAAAAACAGAGAGGGGAAGG - Intronic
1149481825 17:57009685-57009707 TGGCAGAAGCATTGTGGGAAAGG - Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151332669 17:73420085-73420107 AGGCAGGAGCAGGGCGGGCATGG + Intronic
1151392720 17:73798503-73798525 TGGCTGAATCATAGTTGGCAAGG - Intergenic
1151480438 17:74367425-74367447 TGGCAGCAGCAGACAGGACAGGG - Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1153254121 18:3153034-3153056 TGGCAGAAGCTGATAGGGCCAGG + Intronic
1153919779 18:9778258-9778280 TGGCAGGAGCCGTGTGTGCATGG + Intronic
1154365847 18:13708300-13708322 TGGCACACCCAGAGAGGGCATGG - Intronic
1155748368 18:29389476-29389498 TGGCAGCCACAGAGAGGGCATGG + Intergenic
1156537737 18:37880151-37880173 TGGCTGAAGAAGTGTGGGAATGG + Intergenic
1157399615 18:47376631-47376653 TGTCAGAATCACAGGGGGCAGGG - Intergenic
1157787057 18:50493467-50493489 TGGCAGTTGCAGGGTGGTCAAGG + Intergenic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1160383405 18:78478054-78478076 AGGCAAAATGAGAGTGGGCAAGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161431290 19:4233705-4233727 TGGCCACAGCAGAGTGAGCAAGG - Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161629354 19:5344490-5344512 TGGCGGGAGCAGAGTGAGCGAGG - Intergenic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1162087846 19:8259367-8259389 TGGCTGGAGCAGAGTGGGTGAGG + Intronic
1162105808 19:8368982-8369004 TGGCAGGAGGAGGATGGGCACGG + Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1163087723 19:14994382-14994404 GGGCAGATGCAGAGAGGGGAGGG - Intronic
1163364590 19:16868947-16868969 GGGCAGAGGCAGAGAGGTCACGG + Intronic
1163503025 19:17687439-17687461 TGGGAGAACCGGAGGGGGCAGGG + Intronic
1164158498 19:22611033-22611055 TGAGAGAAGGAGGGTGGGCAGGG + Intergenic
1164305268 19:24000643-24000665 TGGCAATAGCAAGGTGGGCAGGG + Intergenic
1164820130 19:31243608-31243630 TAGCAGAAGCAGAGGGGGTGGGG + Intergenic
1164994373 19:32708884-32708906 TGGGAGATGCAGAGAGGGTAAGG - Intronic
1165097806 19:33419257-33419279 TGGCAGGAGCTGAGTAGTCAGGG - Intronic
1165146697 19:33735367-33735389 TGGCAGCAGGAGAGTGTGAATGG + Intronic
1165167739 19:33869009-33869031 TCGCAGGAGCAGTGTGGGCAGGG + Intergenic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165891234 19:39113497-39113519 TGGCTGCAGCAGAGTGGGCGAGG - Intergenic
1165899390 19:39161753-39161775 TGGCTGGAGCAGGGTGGGCGAGG - Intronic
1165940249 19:39411336-39411358 TGGCTGGAGCAGAGTGGCCAAGG - Intergenic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167112017 19:47468183-47468205 TGGCTGAGGCAGACTGGGCAAGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167747953 19:51363896-51363918 TGGCAGAAGCACAAAGGGTAAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168078740 19:53994046-53994068 GGGCACATGCAGAGTGGGCACGG - Intronic
1168082082 19:54017499-54017521 TAGCAGAAGGAATGTGGGCAGGG + Intergenic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168609816 19:57790173-57790195 TGGGAGAAGGAGGATGGGCAAGG + Intronic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925694652 2:6563252-6563274 TGGGAAAAGCAGAGAGGGAAAGG - Intergenic
925897739 2:8486365-8486387 TCACAGAAGCAGAGTGTGAATGG - Intergenic
926335184 2:11857525-11857547 TGGCAGGAGCAGAGTTGGGCAGG + Intergenic
926339593 2:11894208-11894230 TGACAGAAGCAGAGGTGGGAGGG - Intergenic
926542008 2:14192756-14192778 TGGCAAAAGGATATTGGGCAAGG - Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
926933968 2:18068166-18068188 GGGCAGAAGCAGAGAGGGGTGGG - Intronic
928176191 2:29035794-29035816 TGGAAGTGGCTGAGTGGGCAAGG + Intronic
929836404 2:45404834-45404856 TGGCCAGAGCAGAGTGAGCAAGG - Intronic
930126083 2:47797976-47797998 TGAAGGAAGCAGAGTGGGTATGG - Intronic
930203274 2:48564361-48564383 TGGCAGAAAGAGAGTGAGCTAGG + Intronic
930257527 2:49109253-49109275 TTGCAGGAGCAGAGTGGGTGGGG + Intronic
930511410 2:52349908-52349930 TGGCTGCAACAGAGTGGGCAAGG - Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
932055065 2:68435000-68435022 TGGCAAAAGCACAGTGGGCATGG + Intergenic
932311313 2:70744600-70744622 TGGCTGAAGCTGAGTGGCAAAGG + Intronic
932426129 2:71636552-71636574 TGGGAGGAGCAGACTGGGCAGGG + Intronic
932741307 2:74293060-74293082 AGGGTGAAGCAGAGGGGGCAGGG + Intronic
933303153 2:80565595-80565617 TGGTAGAAACAGTGTGTGCATGG + Intronic
933646165 2:84814222-84814244 TGGCAGGAGCAGGAAGGGCAGGG + Intronic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
933713614 2:85344846-85344868 TGAAGGAAGCAGAGTGGCCAGGG - Intronic
935141761 2:100359438-100359460 TGGCACATCCAGAGAGGGCATGG - Intergenic
936084829 2:109460217-109460239 TGGCAGAAGCATTGTGTGTAGGG + Intronic
936646216 2:114375872-114375894 TGGCAGAAGCATTTTGTGCAGGG + Intergenic
936735736 2:115440948-115440970 TGGCAGAAGCGGGTTGGGTAAGG + Intronic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
937841100 2:126525458-126525480 TGGCAGAAGCATTGTGTGTAAGG + Intergenic
938380649 2:130834641-130834663 TGGCAGAGAGAGCGTGGGCACGG - Intergenic
938712826 2:133990311-133990333 TGGCATAAGCATCATGGGCAGGG + Intergenic
938778651 2:134564059-134564081 TGGCGGTGGCAGGGTGGGCAGGG + Intronic
939604664 2:144239016-144239038 TGGCAGAAGTGCAGAGGGCATGG - Intronic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
942145777 2:173024857-173024879 TGGCAGGAGCAGAGAGCACAGGG - Intronic
942891758 2:180998444-180998466 TGGGATAAGGAGAGTGGGGAAGG + Intronic
942937983 2:181581603-181581625 TGACAGAAACATGGTGGGCAGGG + Intronic
943898399 2:193399465-193399487 TGTCAGGAGAAGATTGGGCAGGG + Intergenic
945784708 2:214218501-214218523 TGGCAGGAGCAAAGTGGGAATGG - Intronic
945980637 2:216307653-216307675 TGGGAGAAGCCAAGCGGGCAGGG - Intronic
946079220 2:217102734-217102756 TGGCAGAAGAGGTGAGGGCAGGG - Intergenic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946440837 2:219693762-219693784 TGGCTGGAGCAGAGAGTGCAGGG + Intergenic
946445581 2:219737383-219737405 TGGCACAATCACAGTGTGCAGGG + Intergenic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
947806261 2:232970430-232970452 TGGAGGAAGCAGAGTGGGAAGGG + Intronic
948486387 2:238283911-238283933 AGGCAGCAGCAGAGTGGTTAAGG + Intronic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1169206012 20:3740765-3740787 TGGCACAAGCAGGGTAGGTATGG - Intronic
1170158141 20:13286905-13286927 TGGCAGCAGCAGAGGGCCCAAGG + Intronic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170904058 20:20496020-20496042 TAGCAGTGGCAGAGTGGGCCCGG + Intronic
1171107662 20:22450340-22450362 TGCCAGAAACAGACTGGGCTTGG + Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172021740 20:31919672-31919694 TGGCAGAGGGAGAGAGGGAAGGG - Intronic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1172779607 20:37428255-37428277 TGCCAGCAGCAAAGTGGGGATGG - Intergenic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173341558 20:42157070-42157092 TGGCAGAGGAAGAGTGAGCAAGG - Intronic
1174299259 20:49569565-49569587 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1174308522 20:49632231-49632253 TGGCTGGAGTAGAGGGGGCAGGG - Intergenic
1174321064 20:49741992-49742014 TGGCAGAGGAAGAGTGGGAGAGG - Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174556360 20:51398248-51398270 GGGGAACAGCAGAGTGGGCAGGG - Intronic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175239799 20:57538683-57538705 TGCCAGAAGGACTGTGGGCAAGG + Intergenic
1175270702 20:57731923-57731945 TGGCAGCAGGAGAGAGAGCACGG + Intergenic
1175741918 20:61425523-61425545 TAGGAGAAGGACAGTGGGCAGGG + Intronic
1175816633 20:61886482-61886504 TGGCAGAAGCAGGAAGGGTAGGG + Intronic
1175835205 20:61989307-61989329 GGGAAGCTGCAGAGTGGGCAGGG + Intronic
1175872033 20:62213367-62213389 TGGGGGAAGGAGAGTGGGGATGG + Intergenic
1176443405 21:6798739-6798761 TGGCGGGAGCAGAGGCGGCAGGG - Intergenic
1176821573 21:13663786-13663808 TGGCGGGAGCAGAGGCGGCAGGG - Intergenic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1178257276 21:31065634-31065656 TGGCAGAAGCGTTGTAGGCAGGG - Intergenic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1178697942 21:34810075-34810097 TGGGAGAGGCCGAGGGGGCATGG + Intronic
1179231313 21:39506351-39506373 TGGCTGAAGTAGAGTGGTGAGGG + Intronic
1179269746 21:39841464-39841486 TGGGAGATGCAGACAGGGCATGG + Intergenic
1179582655 21:42353223-42353245 TGGCAGAAGTGGAGTGGAGATGG - Intergenic
1180125807 21:45789621-45789643 TGGCCGGAGCAGAGCGAGCAAGG + Intronic
1180594031 22:16962131-16962153 TGGGAGAGGCAGAGAGGGAAGGG - Exonic
1180713100 22:17853298-17853320 AGGCTGCAGCAGAGTGGGCTGGG - Intronic
1180725559 22:17944353-17944375 TGGCAGTAGGAGAGGGCGCAGGG + Intronic
1180745144 22:18083349-18083371 TAGGAGAAGCATAGTGGTCATGG + Intronic
1181179564 22:21057319-21057341 TGGCAGAAGCAGAGTTGCAACGG + Intronic
1182257414 22:29049163-29049185 TGGAGGAAACAGAGTAGGCAGGG - Intronic
1182458209 22:30466052-30466074 TGCCAGAAGCAGTCTGGGGAGGG + Intronic
1183356284 22:37361506-37361528 GGGCAGGAGCAGGGTGGGCTTGG - Intergenic
1183390184 22:37541279-37541301 TGGCAGAAGGAGGCCGGGCACGG + Intergenic
1183762312 22:39832973-39832995 GTGCAGAAGCCGAGTGGGCAAGG + Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184138358 22:42562539-42562561 TGGAGGACGCAGAGTGGGGAGGG + Intronic
1184411281 22:44327792-44327814 GGGCATAACCAGGGTGGGCAGGG + Intergenic
1184769455 22:46589064-46589086 TGGGAGAAGCAGGGACGGCAGGG + Intronic
1185011212 22:48315734-48315756 TGGCAGGAGCAGACGGGGCCGGG + Intergenic
1185110245 22:48896503-48896525 TGGCAGGAGCAGAGGGGGTCGGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
1185202601 22:49517299-49517321 TGGCAGGAGCAGAGAGGCTATGG - Intronic
949519594 3:4837687-4837709 GGGCAGAAACAGAGTACGCACGG - Intronic
949758327 3:7439483-7439505 AGACAGAAGCAGCATGGGCAGGG - Intronic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
951975691 3:28505256-28505278 TGGCTGAAGAAGAGAGTGCAGGG + Intronic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
953416201 3:42719352-42719374 TGCCTGAGGCAGAGTGGGGAAGG - Intronic
953468410 3:43145861-43145883 TGGCAGAAGCACTGTGAGCAGGG - Intergenic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
954199917 3:49018077-49018099 TGGCTCAAGCGGAGTGCGCAGGG + Exonic
954711339 3:52506483-52506505 TGGCAGAAGCCATGTGGGTAAGG + Intronic
954784874 3:53085254-53085276 CGGGAGAAGCAGAGAGGGCTGGG + Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955520484 3:59770867-59770889 GGGCAGAAGCAGAGTGGCACAGG - Intronic
955800370 3:62680116-62680138 TGGAAGACGGAGAGTAGGCAAGG + Intronic
956084136 3:65591714-65591736 TGGCAGAAATAGAGTGAACAAGG - Intronic
956245085 3:67173956-67173978 TGGCAGGAGTGCAGTGGGCAAGG + Intergenic
956373441 3:68588782-68588804 TGGCAGAAGCAGAGTGAATGAGG + Intergenic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
957199841 3:77119102-77119124 TGGCAGGAGAAGAGAGAGCAAGG - Intronic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
957946591 3:87070851-87070873 TGGAAGAAGCATTGTGGACAAGG - Intergenic
957959891 3:87236046-87236068 TGGCACACACAGAGAGGGCATGG - Intronic
958440744 3:94153442-94153464 TGTCAGCTGCAGAGTGGCCAGGG + Intergenic
958632469 3:96701040-96701062 TATCAGAAACAGAGTGGGCAGGG - Intergenic
959272318 3:104228424-104228446 TGGCACAAGGACAGTGGACAAGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960600540 3:119453661-119453683 TGGAAGAAGCATATTGGGGATGG + Intronic
961042229 3:123685738-123685760 AGGCAGAGGCAGATGGGGCAGGG - Intronic
961397810 3:126609317-126609339 TTCCAGAAGCTTAGTGGGCAAGG - Intronic
961475034 3:127140929-127140951 TGGCAGAGCCAGTGTGGACAGGG + Intergenic
961805713 3:129487933-129487955 TTCCAGAGGCAGAGTGGGGAGGG + Intronic
961878330 3:130041799-130041821 TGGCAGAAATTGACTGGGCATGG + Intergenic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
963661543 3:148133237-148133259 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
963674241 3:148288307-148288329 TGGCACAGGCAGGGAGGGCATGG - Intergenic
963726044 3:148922892-148922914 TGGCATGACCAGAGAGGGCATGG + Intergenic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964747666 3:160027089-160027111 TGGTTAAAGCAAAGTGGGCAAGG + Intronic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966268037 3:178070415-178070437 TGGGGGAAGCAGAATTGGCAAGG + Intergenic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
967036006 3:185648811-185648833 TAGCAGTAGGAGGGTGGGCAAGG - Intronic
967196541 3:187031196-187031218 TGTTGGAAGCTGAGTGGGCATGG + Intronic
967388774 3:188934994-188935016 TGGCAGAATTAGAGAGGGAAGGG + Intergenic
967912315 3:194552511-194552533 TGGCCGCAGCAGAGTGGGCAAGG - Intergenic
967989347 3:195119893-195119915 TGGCTGAAGCAGGGAAGGCAGGG + Intronic
968193511 3:196688525-196688547 GGGCAGCAGCAGCGTGGGAATGG - Intronic
969260585 4:6030849-6030871 AGGCAGAAGCTCTGTGGGCAGGG - Intronic
969517441 4:7655465-7655487 TGGCGGCTGCAGAGTGGGCAAGG + Intronic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969635932 4:8369589-8369611 TGCCAGGAGCCGGGTGGGCAGGG - Intronic
970309599 4:14768262-14768284 TAGCAGAGTCAGATTGGGCAGGG + Intergenic
971200701 4:24507252-24507274 TGGTAGAATCAGAGTGGGTGGGG - Intergenic
971686496 4:29776269-29776291 AGGCAGAAGCTGACTGTGCATGG - Intergenic
972353576 4:38259942-38259964 TGGCAGAAGCCTAGAGGGGAGGG + Intergenic
972788063 4:42346008-42346030 TGGCAGCAGCAGGGGAGGCACGG + Intergenic
973027043 4:45284935-45284957 TGGCGGCAGCAGAGGAGGCATGG - Intergenic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973827497 4:54723334-54723356 TGGCTGAGGCAGAGGTGGCAGGG - Intronic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
974093286 4:57334929-57334951 AGGCAGAAGGAGATTGTGCACGG + Intergenic
975329768 4:73099946-73099968 TGGCAGAAGCAAAGTAAGTATGG - Intronic
975475781 4:74821751-74821773 TGGCAGGAGCACAGTGAGTAAGG + Intergenic
975584342 4:75935787-75935809 TTCCAGAAGCAGCCTGGGCATGG + Intronic
975654885 4:76631641-76631663 TGACAGAAGCACAGCGAGCAGGG + Intronic
975716928 4:77214137-77214159 TGCCAGAAGCAGAGAGGGAGTGG - Intronic
976581451 4:86741193-86741215 TGGTACCAGTAGAGTGGGCATGG - Intronic
977593083 4:98848615-98848637 TGCCTGCAGCAGAGTGGGGAAGG + Intergenic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
981434082 4:144699383-144699405 TGGCACACCCAGAGAGGGCAGGG - Intronic
981574340 4:146188601-146188623 TCTCAGAAGCCGAGTAGGCATGG + Intronic
981605762 4:146538304-146538326 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
982192634 4:152873865-152873887 AGGCAGAGACAGAGTGGGAAAGG - Intronic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984441370 4:179774582-179774604 TGCCTGAGGCAGAGTGGGGAAGG - Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985879639 5:2628570-2628592 GAGCAGGAGCTGAGTGGGCAGGG - Intergenic
985926924 5:3026265-3026287 AGGGAGAGGCAGGGTGGGCAGGG - Intergenic
986179625 5:5381798-5381820 TGGCCCACGCAGACTGGGCAAGG + Intergenic
986253658 5:6083617-6083639 TGGCAGGAGCTGAGTGAGCCAGG - Intergenic
986261481 5:6151424-6151446 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
987849158 5:23326339-23326361 TGACAGAAGAGGAGTGGGGAGGG + Intergenic
988205145 5:28124253-28124275 TGGCAGAAGCACTGCGTGCAAGG + Intergenic
988439704 5:31218890-31218912 TGACTGAAGCAGAGTGTGCTAGG - Intronic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988663826 5:33302978-33303000 TGACAGGAGGAGAGTGAGCATGG + Intergenic
988872751 5:35409181-35409203 TGGCAGAAGGAGAGAAGGAAAGG + Intergenic
988998213 5:36734681-36734703 TGTCAGGAGCAGAATGGGTATGG - Intergenic
989178412 5:38553057-38553079 AGGCAGAAGAAGAGTGGGCTGGG - Intronic
990473689 5:56141624-56141646 TGGCACACCCAGAGAGGGCACGG + Intronic
990726870 5:58765942-58765964 AGGAGGAAGAAGAGTGGGCAGGG - Intronic
990879635 5:60524671-60524693 AGGCAGAGGGAGAGAGGGCAGGG - Intergenic
990986970 5:61649591-61649613 TGGCAGGAACAGAGTGCACAGGG - Intronic
991041672 5:62182621-62182643 TGGCAGGAGAGGAGAGGGCATGG - Intergenic
991377763 5:65984254-65984276 TGAGAGAAGCTGAGTGGGCAGGG - Intronic
991519539 5:67480454-67480476 TGGCAGAAGCAGCATAGTCAAGG + Intergenic
991924863 5:71695210-71695232 TGGCAGCAGCAGCCTGGGCGCGG - Intergenic
992127250 5:73654419-73654441 TGGCAGTAGGGGAGTGGGCTAGG + Intronic
992134334 5:73728134-73728156 TGGTAGAAGCAAAGTTGGAAGGG - Intronic
992341347 5:75826645-75826667 TGGCAGAAGCATAGCAGGCAGGG + Intergenic
992640316 5:78763377-78763399 TGACAGAAGGAGGCTGGGCACGG - Intronic
992763159 5:79969712-79969734 GGTCAGGAGCAGAGTGAGCAGGG - Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
994142076 5:96352864-96352886 TGGCAGCAGGAGAGAGAGCAAGG - Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995528260 5:113068020-113068042 GGGCAGAAGCAAAGGAGGCAGGG + Intronic
996245816 5:121263058-121263080 TGCCAGCAGCAGTGTGAGCATGG + Intergenic
996381577 5:122867326-122867348 TGGCAGAAGCATTGTGTGCAGGG + Intronic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997266454 5:132497717-132497739 TGGCAGGACCTGAGTGGGCTAGG - Intergenic
997267482 5:132503560-132503582 TGGCTGCAGCATGGTGGGCAAGG + Intergenic
997441472 5:133911645-133911667 TGAAACAAGCAGTGTGGGCAGGG - Intergenic
997459636 5:134043120-134043142 TGGCAGGAGAAGAGTGATCAAGG + Intergenic
998234190 5:140383707-140383729 TGGAAGAAGTAGTGTGGGCAAGG + Intergenic
998522967 5:142817281-142817303 GAGCAGGAGCAGAGTTGGCAAGG + Intronic
999062280 5:148648716-148648738 TAGCAGAAGCATAGTTGCCACGG - Intronic
999197806 5:149794650-149794672 AGGCAGGAGAAGGGTGGGCAAGG + Intronic
999576840 5:152988297-152988319 TGACTGAGGCAGAGTGTGCAGGG + Intergenic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
1000131449 5:158304259-158304281 TGGGAGAATCAGACTGGGCTGGG + Intergenic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002340367 5:178512837-178512859 TGGCAGGAGCAGAATAGGCATGG - Intronic
1002968729 6:1992627-1992649 GGGCGGAGGCAGTGTGGGCATGG - Intronic
1003116790 6:3288754-3288776 AGGCAGCAGCAGAGTGGCCAAGG + Intronic
1003567196 6:7231239-7231261 TGGCAAAAGCAGCGGGGGCTTGG - Exonic
1004298731 6:14437758-14437780 TGGCAGAAGCACTGCAGGCAAGG - Intergenic
1004583352 6:16975768-16975790 TGGCAGAATCCCAGTGGGCTGGG - Intergenic
1005352496 6:24949954-24949976 TGGAGGAAGCAGAGCGGGGAAGG + Intronic
1005969468 6:30749876-30749898 TGGCGGAGGCAGAATGGGCAGGG + Intergenic
1005983686 6:30856755-30856777 TGGTAGAGGCAGAGGGGGCTGGG - Intergenic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006823743 6:36918508-36918530 TGGCAGCAGCAGAGAGAACAGGG + Intronic
1007238980 6:40411575-40411597 TGGCTGAAGCACAGAGTGCAGGG - Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007630795 6:43272177-43272199 AGTCAGCAGCAGTGTGGGCAAGG + Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1008079588 6:47180134-47180156 TGTCAAAGGCAGGGTGGGCATGG - Intergenic
1008206093 6:48659151-48659173 GTGCAGAAACTGAGTGGGCAGGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008656548 6:53619756-53619778 TGGCACATGCAGAGAGGGCATGG - Intergenic
1009057156 6:58349729-58349751 TGGCAGGTGTAGAGTGGGGAAGG + Intergenic
1009195369 6:60678327-60678349 AGGAAGGAGAAGAGTGGGCAAGG + Intergenic
1009234081 6:61101826-61101848 TGGCAGGTGTAGAGTGGGAAAGG - Intergenic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1011057814 6:83224775-83224797 TGGCAGGAGTAGAATTGGCAAGG + Intronic
1011306043 6:85927980-85928002 TGGGAGTAGGAGAGTGGGGATGG - Intergenic
1012129101 6:95468871-95468893 TGACAGAAGCAGTGAGGGCAAGG - Intergenic
1012222656 6:96668541-96668563 TGGCAGAAACATTGTGGACAGGG - Intergenic
1012402942 6:98859381-98859403 TGGCAGAAGCATTGTGTGCGGGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012523174 6:100145083-100145105 TCACAGATGCAGAGTGGTCAGGG - Intergenic
1013066867 6:106692664-106692686 TGGCAGAAAGAGAGGGTGCAGGG + Intergenic
1013150154 6:107438048-107438070 TGACAGAAACGAAGTGGGCATGG + Intronic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1014372823 6:120633899-120633921 TCACAGAAGCAGAGAGGGAATGG + Intergenic
1015484388 6:133752007-133752029 TGCAAGAAGCAGAGTGGGAATGG - Intergenic
1015527537 6:134187776-134187798 TGGCAGAAGCATTGTGTTCAAGG + Intronic
1017043929 6:150329847-150329869 TGGCAGAAGCATTATGTGCAGGG + Intergenic
1017384049 6:153861936-153861958 TGGCAGCAGCAGGCTGAGCATGG - Intergenic
1017426154 6:154323427-154323449 TGGCAGAATGAGAGAGGGAAGGG - Intronic
1017648705 6:156562322-156562344 GTGCAGAGGCAGAGTGGCCACGG + Intergenic
1017701485 6:157077415-157077437 TGGCAGAGGCAGGCTGCGCATGG - Intronic
1018516376 6:164584261-164584283 TGGCAGAGGCAGCATCGGCAGGG + Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019411252 7:907779-907801 TGGCAGCAGCTGCGTGGCCAGGG + Intronic
1020007109 7:4788908-4788930 TGCCTGCAGCAGCGTGGGCACGG - Exonic
1020583179 7:10031541-10031563 TAGCAGAAGCATTGTGTGCAGGG + Intergenic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021816912 7:24456091-24456113 GAGGAAAAGCAGAGTGGGCATGG - Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1022778425 7:33552943-33552965 TGGGTAAAGCAGAATGGGCAAGG - Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1023115078 7:36854887-36854909 GTGCAGACGCAAAGTGGGCATGG + Exonic
1023483764 7:40662504-40662526 TGGCAGAAGCACAGTGAACAAGG - Intronic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024541737 7:50480316-50480338 TGGCATACACAGAGAGGGCATGG + Intronic
1025723652 7:64038157-64038179 TGTCAGAAGCGGGGTAGGCAGGG - Intronic
1025818924 7:64945511-64945533 AGCCAGAACCAGAGGGGGCAGGG - Intergenic
1026024191 7:66732061-66732083 TGGCAGAAGCAGGCTGGGCTGGG - Intronic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026888915 7:73970953-73970975 TGGCAGAAGCAGGCTGGGCTGGG - Intergenic
1026951984 7:74353818-74353840 TGGCACAGGCAGAGATGGCAGGG - Intronic
1027798866 7:82726604-82726626 TGGCCACAGCAGAGTGAGCAAGG + Intergenic
1027861219 7:83584632-83584654 TGGCAGGAGAAAAGTGGGGAAGG - Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1029098355 7:98107036-98107058 TGGCAGAAGCAACGTGTGCTCGG + Exonic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1030109239 7:106012486-106012508 TGGCAGGAGGAGAGTGAACAAGG + Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1032088576 7:128896995-128897017 TGCCTGAGGCAGAGTGGGAAAGG - Intronic
1032184496 7:129712548-129712570 TGGCACATGCAGGGTGGCCAAGG - Intronic
1033315580 7:140294576-140294598 TGGCAGAAGTATTGTGGGTAGGG + Intronic
1033601896 7:142894369-142894391 TGGCAGCAGCTGAGGGGGCCAGG + Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1034357118 7:150459862-150459884 TGGCAAAAGCATTGTGTGCAGGG + Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034870567 7:154679559-154679581 TGGCTGTAGCAAAGGGGGCAGGG + Intronic
1034976747 7:155453645-155453667 TTGGGGAAGCAGAGTGGGCCAGG - Intergenic
1035811657 8:2496616-2496638 TGGCAGAGGAAGAGAAGGCAGGG + Intergenic
1036157337 8:6354896-6354918 AGGCAGAAGCCCAGTGGGAAGGG - Intergenic
1037572367 8:20169369-20169391 TGACACAATCAGAGTAGGCACGG + Intronic
1037654570 8:20872107-20872129 TGGCAGGGGCAGGGTGTGCAGGG + Intergenic
1037920910 8:22804843-22804865 TGGCTGCAGCAGGGTGGTCACGG - Intronic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1038926297 8:32143647-32143669 TGTGAGAAGCAGTGAGGGCAAGG + Intronic
1039527106 8:38226661-38226683 TGGCTGAAGCATTATGGGCAGGG + Intronic
1039615240 8:38950399-38950421 TGCTGGAAACAGAGTGGGCAGGG - Intronic
1041512425 8:58666610-58666632 AGGCAGAAGCAGGTTGGGAATGG + Intergenic
1041804581 8:61836442-61836464 TGGCAGCAGTAGACTGAGCAGGG + Intergenic
1043237694 8:77889384-77889406 AGGCAGAAGCACTGTGGGCAAGG - Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1045007783 8:97931253-97931275 TCTCAGAAGCAGAGGGGGCCCGG + Exonic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1046384902 8:113496557-113496579 TGGCAGAAGCACAGCATGCAGGG - Intergenic
1046635403 8:116669900-116669922 TGGTAGAAGCAGAGTGTGTAGGG - Intronic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047618982 8:126587083-126587105 TGGCTGGAGAAGAGAGGGCAGGG + Intergenic
1047915845 8:129582978-129583000 TGGGAGGAGCACAGTGAGCAAGG + Intergenic
1049447090 8:142636155-142636177 AGGCCGGAGGAGAGTGGGCAGGG + Intergenic
1049864072 8:144922299-144922321 TGGCAGCACCAGAGTGGGCAGGG + Intergenic
1050242479 9:3651575-3651597 TGGCAGAAGACGAGTGGGCAGGG - Intergenic
1051463351 9:17348895-17348917 TGGCTGGAGTAGGGTGGGCATGG + Intronic
1051963470 9:22797240-22797262 TGGTAGGAGCAGAATGGGAACGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052292032 9:26852975-26852997 AGGCAGGAGCAGAGAGAGCAAGG + Intronic
1052577427 9:30307594-30307616 TGGCAGAAGAATGGTGTGCAGGG - Intergenic
1052887182 9:33661127-33661149 TGACAGAGGAAGAGTGAGCAGGG + Intergenic
1052895357 9:33742540-33742562 TGGCAGAAGCATTGTGTGCAGGG + Intergenic
1052935971 9:34093475-34093497 TGGCATCAGCAGAGAGGGTAAGG + Intronic
1053121892 9:35553704-35553726 TGGCTGGAGCACAGTGGGCCAGG + Intronic
1053341293 9:37336472-37336494 TGGAATAAGCAGAGTTGGGATGG + Intronic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1054258995 9:62843623-62843645 TGGCAGGAGCAGAGCGAGCCTGG + Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1054749176 9:68886921-68886943 TGGCTGTAGCAGAGAGGGCAAGG - Intronic
1055257933 9:74394416-74394438 TGGAAGGAGCAGTGTGTGCAAGG - Intergenic
1055677793 9:78682856-78682878 TGGGAGAAGGAGAGAGGGAAGGG - Intergenic
1056956516 9:91086086-91086108 TGGCACACTCAGAGGGGGCATGG + Intergenic
1057077887 9:92148798-92148820 GGGCAGAGGCAGAGGAGGCAAGG - Intergenic
1057695125 9:97317704-97317726 TGGCAGAAGAAGCATGGACAAGG - Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057892969 9:98883074-98883096 TGACAGAAGAAGGTTGGGCAGGG + Intergenic
1058178841 9:101771201-101771223 TGTCAGAAGGGGAGTAGGCAGGG - Intergenic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1059436174 9:114277780-114277802 GGGCAAAACCAGAGAGGGCAGGG - Intronic
1059592599 9:115678331-115678353 TGGCAGAAGCATTGTATGCAGGG - Intergenic
1060207143 9:121688855-121688877 TGGCAGAAGTGGAGAGGTCACGG - Intronic
1060262414 9:122088057-122088079 GGACTGAAGGAGAGTGGGCAAGG + Intronic
1060725025 9:126000868-126000890 AGCCAGAAGCACAGTGGGTACGG + Intergenic
1060817416 9:126642494-126642516 TGGGAGAAGCAGAGTTTGCCCGG - Intronic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1062057036 9:134474131-134474153 TGACTGCAGCAGAGTGGGCTGGG + Intergenic
1062288746 9:135785344-135785366 CCGCAGAAGCTGCGTGGGCACGG - Intronic
1203525796 Un_GL000213v1:85788-85810 TGGCGGGAGCAGAGGCGGCAGGG + Intergenic
1186543026 X:10420307-10420329 TCGCAGGAGAAGAGCGGGCAGGG - Intergenic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1188030520 X:25258481-25258503 TGGCAGAAGCTAAGAGGGAAGGG + Intergenic
1188137311 X:26505225-26505247 TGGAAGAAGCAGAGTGGGTGGGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1190172127 X:48119993-48120015 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190180391 X:48186942-48186964 GGGCAGAATCGGAGTGGGCAGGG - Intronic
1190183747 X:48217323-48217345 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190189664 X:48266746-48266768 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190193399 X:48296131-48296153 GGACAGAATCAGAGTGTGCAAGG - Intergenic
1190196891 X:48327370-48327392 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190199366 X:48347121-48347143 GGGCAGAATCGGAGTGTGCAGGG - Intronic
1190204587 X:48392648-48392670 GGGCAGAATCACAGTGTGCAGGG + Intronic
1190205949 X:48402755-48402777 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190210425 X:48442279-48442301 GGGCAGAATCGGAGTGGGCAGGG + Intergenic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190561105 X:51686093-51686115 TGGCAGAAGCAGTGTTGGACAGG + Intergenic
1190563186 X:51707224-51707246 TGGCAGAAGCAGTGTTGGACAGG - Intergenic
1190584301 X:51922716-51922738 AGGCAGATGCAGAGAGGGAAAGG - Intergenic
1190658426 X:52633250-52633272 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190659907 X:52644756-52644778 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190663628 X:52677732-52677754 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190666135 X:52697603-52697625 GGGCAGAATCGGAGTGTGCAGGG - Intronic
1190673283 X:52760807-52760829 GGGCAGAATCGGAGTGTGCAGGG + Intronic
1190675795 X:52780690-52780712 GGACAGAATCAGAGTGTGCAGGG - Intronic
1190676824 X:52789588-52789610 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190737055 X:53262561-53262583 TGGAAGGAGCAGACTGGGCCAGG + Intronic
1191075144 X:56445032-56445054 TGCCAGCAGCAGAGGGAGCATGG + Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191631421 X:63325958-63325980 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1193971677 X:88063045-88063067 GGGCAGAAGTGGAGTGTGCAGGG - Intergenic
1194566396 X:95494282-95494304 TGGCTGAAGCAGCTGGGGCACGG - Intergenic
1194626731 X:96234099-96234121 TGGCAGAAGCATTGTGTGTAGGG - Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195662861 X:107398261-107398283 TTGGAGAAGCACAGTGGCCAGGG - Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1197287019 X:124607608-124607630 TGGGAGAAGCAGATTGGGTAGGG + Intronic
1197891325 X:131273411-131273433 TGGCAGAATAAGAGAGTGCAGGG - Intergenic
1198143821 X:133834231-133834253 TGGCAGATGCAGACTGCACAAGG + Intronic
1198170152 X:134097333-134097355 TGGTAGAAGCATTGTGTGCAGGG - Intergenic
1198517016 X:137419750-137419772 AGACAGCAGTAGAGTGGGCAAGG + Intergenic
1199021385 X:142882195-142882217 TGGCAGAAGCATTGTGTGCAGGG - Intergenic
1201543026 Y:15129969-15129991 TGGTAGAAGGAAAGTGGGCATGG + Intergenic
1202150833 Y:21842409-21842431 TGGCAGAGGCAGAGTCGGTCTGG + Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic