ID: 1013548601

View in Genome Browser
Species Human (GRCh38)
Location 6:111184912-111184934
Sequence TGTAGCTATTAGACCTTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013548598_1013548601 10 Left 1013548598 6:111184879-111184901 CCAGATGCTGCCAAGGGTCAATC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1013548601 6:111184912-111184934 TGTAGCTATTAGACCTTGCTAGG 0: 1
1: 0
2: 2
3: 9
4: 132
1013548600_1013548601 0 Left 1013548600 6:111184889-111184911 CCAAGGGTCAATCAACACTGGAA 0: 1
1: 0
2: 0
3: 7
4: 162
Right 1013548601 6:111184912-111184934 TGTAGCTATTAGACCTTGCTAGG 0: 1
1: 0
2: 2
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013548601 Original CRISPR TGTAGCTATTAGACCTTGCT AGG Intronic
904763064 1:32818932-32818954 TGTACCTGTCAGACCCTGCTTGG + Intronic
906256187 1:44352392-44352414 TCTATCTATGAGACCTTGCTAGG - Intronic
906596730 1:47084531-47084553 TGTCCCTTTTAGAGCTTGCTGGG - Intronic
909679167 1:78272163-78272185 TCTAGATATTAGACCTTTGTTGG + Intergenic
911391753 1:97253954-97253976 TATTGCTATTATTCCTTGCTAGG - Intronic
911940570 1:104042114-104042136 TCTAGATATTAGACCTTTGTCGG + Intergenic
912256376 1:108062824-108062846 TCTAGATATTAGACCTTTGTTGG - Intergenic
915983919 1:160443983-160444005 TGTAGATATTAGGCCTTTGTTGG + Intergenic
918006766 1:180548589-180548611 TGTAGCTAGTAGACCTAACCTGG + Intergenic
919947540 1:202330990-202331012 TGTAGATATTGGACCTGCCTAGG - Intergenic
1063305030 10:4890096-4890118 TGTAGCTCTTAGCCCTTAGTAGG - Intergenic
1067005593 10:42658137-42658159 TGTAGCTATTATACCTTTGCTGG - Intergenic
1067060241 10:43074673-43074695 TGTAGCCATTGGGCCTTCCTGGG - Intergenic
1069232636 10:66030800-66030822 TCTAGATATTAGACCTTTGTTGG - Intronic
1073803188 10:107066193-107066215 TGTAGCTCTGAGCCCATGCTTGG + Intronic
1077526021 11:3065559-3065581 TCTGGATATTAGACCTTGGTCGG + Intergenic
1078519746 11:12053403-12053425 TGTAGCTCATAGACCTTGAAAGG + Intergenic
1080402256 11:31947182-31947204 TATAGCAATTGGACATTGCTGGG - Intronic
1082745206 11:56953590-56953612 TGTTGATATTAGACCTTTGTTGG - Intergenic
1084437311 11:69151431-69151453 TCTGGATATTAGACCTTGGTCGG - Intergenic
1087507680 11:99046617-99046639 TGAAGATATTATACCTTTCTCGG - Intronic
1087671936 11:101116846-101116868 TGTACCCATTTGATCTTGCTAGG - Intronic
1088353889 11:108921662-108921684 AGTAGCTATTAGTCCTGGCCGGG + Intronic
1090729985 11:129562939-129562961 TCTGGATATTAGACCTTTCTTGG - Intergenic
1090784661 11:130038717-130038739 TGTAGAAATTATACCTCGCTGGG + Intergenic
1091964664 12:4728419-4728441 TATATCTAAGAGACCTTGCTTGG + Intronic
1093498733 12:19785436-19785458 TCTAGATATTAGACCTTTATTGG + Intergenic
1093793468 12:23283408-23283430 TGTTGTTATTAGACCTTTGTTGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095400234 12:41806008-41806030 TGTGGATATTAGACCTTTGTTGG + Intergenic
1097585457 12:61510352-61510374 TCTAGATATTAGACCTTTGTTGG + Intergenic
1098367863 12:69723989-69724011 TGTTTCTATTAGACCTTCTTAGG - Intergenic
1100878096 12:98984486-98984508 TGTAGCTTTAACACCTTTCTTGG + Intronic
1101041949 12:100764517-100764539 TGTTGCTATTAGAGTTTGCAAGG - Intronic
1101399595 12:104375975-104375997 TGGATCTGTTAGACGTTGCTGGG + Intergenic
1103891826 12:124244963-124244985 TCTAGATATTAGACCTTTATTGG + Intronic
1104487160 12:129161692-129161714 TGTGGCTACTACACCTTGCCAGG - Intronic
1104499637 12:129272671-129272693 TTTAGATATTAGACCTTAATTGG + Intronic
1106786196 13:33110166-33110188 TTTTGCTATCATACCTTGCTGGG + Intronic
1111181910 13:84680242-84680264 TGTAGATATTAGTCCTTTGTTGG + Intergenic
1118665977 14:68070169-68070191 TCTGGATATTAGACCTTGGTTGG + Intronic
1122826248 14:104372256-104372278 GATAGCTATGGGACCTTGCTTGG - Intergenic
1126528570 15:49686650-49686672 TGTTTCTATTAGACAGTGCTGGG + Intergenic
1137832309 16:51555534-51555556 AGTAGCTATAAGACATTGCAGGG + Intergenic
1139850616 16:69950000-69950022 GGTAGCTATTAAGCATTGCTAGG + Intergenic
1139879600 16:70172912-70172934 GGTAGCTATTAAGCATTGCTAGG + Intergenic
1140372926 16:74422636-74422658 GGTAGCTATTAAGCATTGCTAGG - Intergenic
1141211429 16:81984076-81984098 TATAGATATTAGACCTTTGTTGG - Intergenic
1153497335 18:5712880-5712902 TGTCGCTATGAGACCTTCCTTGG + Intergenic
1153626332 18:7025175-7025197 TGTGACTATAAGACCTTGCCTGG + Intronic
1157448199 18:47764070-47764092 TCTGGCTATTAGACCTTTGTTGG - Intergenic
1159694370 18:71536203-71536225 TATAGATATTAGACCTTTGTTGG + Intergenic
927775837 2:25902399-25902421 AGTAGCTATTAGACCTTGGTGGG + Intergenic
933375633 2:81476883-81476905 TCTAGCTATTAAACCTTTGTTGG - Intergenic
935713797 2:105921696-105921718 TCTGGATATTAGACCTTTCTTGG - Intergenic
939186783 2:138870407-138870429 TCTGGATATTAGACCTTGGTTGG + Intergenic
939569450 2:143823377-143823399 AGTAGCTCTTATACCTTTCTTGG - Intergenic
941017062 2:160369508-160369530 TGTAGCTATTAGAACTAGACAGG + Intronic
941360269 2:164542503-164542525 TCTAGATATTAGACCTTTGTTGG - Intronic
942796524 2:179826930-179826952 TGTAGTATTTAGACCATGCTAGG - Intronic
943291170 2:186073646-186073668 TCTAGATATTAGACCTTTGTCGG - Intergenic
944263870 2:197703362-197703384 TCTGGATATTAGACCTTTCTTGG + Intronic
946878382 2:224153095-224153117 TCTAGATATTAGACCTTTGTTGG + Intergenic
947363798 2:229373197-229373219 TCTGGGTATTAGACCTTTCTTGG - Intronic
1177372057 21:20217503-20217525 TCTGGCTATTAGACCTTTTTTGG - Intergenic
950925625 3:16738315-16738337 TCTAGCTAATAGACCCAGCTGGG + Intergenic
951371496 3:21855445-21855467 TGTGGCTATAAGATCTTCCTCGG + Intronic
957992151 3:87639894-87639916 TCTAGCTATTAGACCTCCCTGGG + Intergenic
958688242 3:97426797-97426819 TCTAGATATTAGACCTTTGTTGG - Intronic
958754320 3:98232490-98232512 TGTAGATATTAGACCTTTGTTGG - Intergenic
964054403 3:152434931-152434953 TCTAGATATTAGACCTTTGTGGG + Intronic
964120318 3:153176478-153176500 TCTAGATATTAGTCCTTTCTTGG + Intergenic
964134095 3:153324936-153324958 TGTGGGTATTAGACCTTTGTTGG + Intergenic
967239445 3:187422875-187422897 TGTGGATATTAGACCTTCTTTGG - Intergenic
970216678 4:13766143-13766165 TGTATGTATTAGATCTTGCGAGG - Intergenic
972411492 4:38800021-38800043 TGTAGGTATGAGACAGTGCTTGG + Intronic
973105062 4:46325464-46325486 TCTGGCTATTAGACCTTTGTTGG + Intronic
974920141 4:68228911-68228933 TGCAGATCTTAGACTTTGCTGGG + Intronic
975239554 4:72041874-72041896 TGTGGATATTAGACCTTTGTTGG + Intronic
975712077 4:77170921-77170943 TGTGGCTATCTGATCTTGCTGGG + Intronic
976120746 4:81778468-81778490 TCTAGATATTAGACCTTTGTCGG + Intronic
976804721 4:89034183-89034205 TCTAGATATTAGTCCTTTCTTGG - Intronic
977322438 4:95534822-95534844 TGTAGAACTTTGACCTTGCTTGG + Intronic
978087747 4:104674992-104675014 GGTAGTTATTAGACCTTTGTTGG + Intergenic
980404564 4:132339723-132339745 TCTGGATATTAGACCTTTCTTGG + Intergenic
980514413 4:133835762-133835784 TGGAGCAATTAGACCTCCCTAGG - Intergenic
981361931 4:143856309-143856331 TGAAACTATCAGAACTTGCTAGG + Intergenic
981372667 4:143977205-143977227 TGAAACTATCAGAACTTGCTGGG + Intergenic
981381755 4:144080419-144080441 TGAAACTATCAGAACTTGCTAGG + Intergenic
981439480 4:144767049-144767071 GGTGGTTATTAGACCTTTCTTGG - Intergenic
982990535 4:162268360-162268382 TCTAGATATTAGACCTTTTTTGG - Intergenic
984795467 4:183656517-183656539 TGTAACTAGTAATCCTTGCTTGG + Intronic
986509449 5:8488622-8488644 TGTGTCTTTTAGACCTTTCTAGG + Intergenic
989413942 5:41151958-41151980 TGTAGCTATTAATCCCTGCATGG + Intronic
991521293 5:67500148-67500170 TCTAGATATTAGACCTTTGTTGG + Intergenic
994050550 5:95357471-95357493 GCTAGCTATTAGTTCTTGCTGGG - Intergenic
994225658 5:97249482-97249504 TGAAGCTATAAGAGCTGGCTTGG - Intergenic
997662818 5:135602569-135602591 TGTAGCCATCAGTCCTTGCATGG + Intergenic
998766646 5:145495762-145495784 TGTACTCATTAGACTTTGCTGGG + Intronic
1001172674 5:169435584-169435606 TGTAGCCATTAGACCATAATCGG + Intergenic
1003092033 6:3112390-3112412 TGTTGGTATTAGACCTTCCTGGG - Intronic
1009416791 6:63424585-63424607 TCTAGTTATTAGTCCTTTCTTGG - Intergenic
1010135004 6:72541604-72541626 TCTAGATATTAGACCTTTATTGG + Intergenic
1010762955 6:79745710-79745732 TCTAGATATTAGACCTTTGTTGG + Intergenic
1012805051 6:103883356-103883378 TGTGACTATTACACCTTGCTTGG + Intergenic
1013548601 6:111184912-111184934 TGTAGCTATTAGACCTTGCTAGG + Intronic
1013697169 6:112717056-112717078 GGTAGCAATTAGACCTGGGTAGG - Intergenic
1015887888 6:137939121-137939143 TGTATCTATTACAGCTTTCTGGG + Intergenic
1021436258 7:20619568-20619590 TCTAGATATTAGACCTTTGTAGG + Intronic
1021470158 7:20993113-20993135 TCTAGATATTAGACCTTTGTTGG - Intergenic
1022783298 7:33608747-33608769 TGTGGATATTAGACCTTTGTTGG + Intergenic
1023497224 7:40810653-40810675 TCTAGGTATTAGACCTTTGTTGG + Intronic
1024848376 7:53678347-53678369 TCTAGATATTAGACCTTTATTGG + Intergenic
1028625662 7:92874186-92874208 TGTTGATGTTAGACCTGGCTGGG - Intergenic
1028860761 7:95647567-95647589 TCTGGCTATTAGACCTTTGTTGG + Intergenic
1031265521 7:119574797-119574819 TATTGATATTAGACCTTGGTTGG + Intergenic
1031434821 7:121720440-121720462 TGTAGATATTAGACCTTTGTTGG + Intergenic
1037754670 8:21703147-21703169 TGTAGCTGTGAGACCTTTGTAGG - Intronic
1041356144 8:57002836-57002858 TCTAGATATTAGACCTTTGTTGG + Intergenic
1043930503 8:86085336-86085358 TGTGGATATTAGACCTTTGTTGG - Intronic
1043963602 8:86446380-86446402 TCTAGATATTAGACCTTTGTTGG + Intronic
1045233963 8:100333396-100333418 TGTAGCTATGTGAACTTCCTTGG - Intronic
1046977021 8:120290869-120290891 TGAAGCTTTCAGACCTTGATAGG + Intronic
1047657026 8:126989102-126989124 TGTAGATATTAGTCCTTTGTTGG + Intergenic
1049093977 8:140537264-140537286 TCTAGCTATTAGACCTGGCTTGG + Intronic
1051442785 9:17104159-17104181 TTTAGATATTAGACCTTTGTCGG + Intergenic
1051521579 9:17995126-17995148 TGTAGCTAAAAGACATTGCTGGG - Intergenic
1051613602 9:18985476-18985498 TGTAGCAATCAGAGCTGGCTAGG + Intronic
1052402517 9:28018455-28018477 TCTAGATATTAGACCTTTGTTGG - Intronic
1056012673 9:82348506-82348528 TCTAGATATTAGACCTTTGTTGG + Intergenic
1056785013 9:89585434-89585456 TATAGATATTAGACCTTGGTTGG - Intergenic
1057008654 9:91582889-91582911 AGTTGCTATGAGAACTTGCTTGG + Intronic
1059868906 9:118548862-118548884 TCTAGATATTAGACCTTTGTTGG - Intergenic
1061825124 9:133253156-133253178 TGCATCTATTCTACCTTGCTTGG - Intronic
1186581343 X:10822588-10822610 TCTAGATATTAGACCTTTGTAGG - Intronic
1187985461 X:24805930-24805952 TGTGTCTAGTAGACCTTTCTGGG + Intronic
1188315472 X:28668036-28668058 TGTAGCAATTAGGCGGTGCTTGG + Intronic
1190027830 X:46942106-46942128 TCTAGATATTAGACCTTTGTTGG + Intronic
1191599348 X:62985689-62985711 TATAGATATTAGACCTTTGTTGG + Intergenic
1191850943 X:65585844-65585866 TGTGGATATTAGACCTTTGTTGG + Intergenic
1193035297 X:76943885-76943907 TGTGGATATTAGACCTTTGTTGG + Intergenic
1196484863 X:116194664-116194686 TCTAGATATTAGACCTTTGTTGG - Intergenic
1198277272 X:135107130-135107152 TCTAGATATTAGGCCTTTCTTGG + Intergenic
1199706663 X:150432305-150432327 TCTAGATATTAGACCTTTGTTGG + Intronic