ID: 1013552005

View in Genome Browser
Species Human (GRCh38)
Location 6:111217094-111217116
Sequence CTCCAATAGCAGTCAGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013552005_1013552015 27 Left 1013552005 6:111217094-111217116 CCCTAGCCTGACTGCTATTGGAG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data
1013552005_1013552010 -10 Left 1013552005 6:111217094-111217116 CCCTAGCCTGACTGCTATTGGAG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1013552010 6:111217107-111217129 GCTATTGGAGGGCACCCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1013552005_1013552014 26 Left 1013552005 6:111217094-111217116 CCCTAGCCTGACTGCTATTGGAG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1013552014 6:111217143-111217165 ACAGCCTGCTGCTGCCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013552005 Original CRISPR CTCCAATAGCAGTCAGGCTA GGG (reversed) Intronic
905149580 1:35917195-35917217 CTCCAAGAGCAGACAGGTTGTGG - Intronic
906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG + Intergenic
913662104 1:121013182-121013204 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914013478 1:143796367-143796389 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG + Intergenic
914652103 1:149704976-149704998 CTCCCATAGCAACCAGGCCAGGG - Exonic
914839202 1:151233818-151233840 CTCCAATAGCAATCAGAGTAAGG - Intronic
918881148 1:190122928-190122950 CCTCAATAGCAGACAGTCTAGGG + Intronic
921722426 1:218488004-218488026 CTCCCATAGCAGTCAGGAGCAGG + Intergenic
922441436 1:225658330-225658352 CTCCAAAACCATTCAGGCTATGG - Intergenic
924174497 1:241376329-241376351 CTCCAATAGCAGTATGGGAAAGG - Intergenic
1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG + Intergenic
1064346062 10:14533878-14533900 CTCTAATAGGAGACAGGCTTGGG - Intronic
1067774756 10:49155053-49155075 CTACAATTGCCATCAGGCTAAGG - Intronic
1070355977 10:75640661-75640683 TTCCCATAGCGGTCAGGCTGGGG + Intronic
1072758021 10:98033438-98033460 CTCCAAATGCAGTCACACTAAGG - Intergenic
1075331391 10:121576764-121576786 GTCCCTTAGCAGTAAGGCTATGG + Intronic
1075809429 10:125214248-125214270 CTCACATTGCAGTCAGGCTGGGG - Intergenic
1076741022 10:132485294-132485316 CTCCAAAAGCTCTAAGGCTATGG - Intergenic
1077051814 11:569934-569956 CTCCTAGGGCAGTCAGACTAGGG + Intergenic
1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG + Intergenic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1085854239 11:80158053-80158075 CTCAAATAGCTGTCAGACAAAGG - Intergenic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1090162506 11:124510386-124510408 CTGCAATGGCAGTCAGGGGACGG + Intergenic
1091860304 12:3775554-3775576 GTGCAAGAGCAGTGAGGCTAGGG - Intergenic
1093135315 12:15442691-15442713 CACCAATAGCATTCAAGCTGAGG + Intronic
1100767862 12:97887530-97887552 CTCCAAAACCAGGCAGGCTCTGG + Intergenic
1106965740 13:35064635-35064657 CTCCAAAAACAGTCAGATTACGG - Intronic
1119579517 14:75764609-75764631 CTCCATCAGCAGTCATTCTAGGG - Exonic
1123120476 14:105914034-105914056 CTCCAATACCAGTCCGGATGGGG - Intergenic
1123833351 15:24164301-24164323 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123840079 15:24239380-24239402 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123853023 15:24379895-24379917 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123868981 15:24552463-24552485 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG + Intergenic
1124078255 15:26466746-26466768 CACCAATAACAGTCAGGTCAAGG + Intergenic
1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG + Intronic
1136126844 16:28189480-28189502 GTCCTATCACAGTCAGGCTAAGG - Intronic
1144420016 17:15087961-15087983 CTCAAATAGCTGTCAGCATAGGG + Intergenic
1146911000 17:36648469-36648491 CTCCAATTGAAGTCAGCCTATGG + Intergenic
1147703047 17:42407912-42407934 CTCCAGTAGCAGGCAGGGTAAGG - Intronic
1152944122 17:83189817-83189839 CTCCAGCAGCAGGCAGGCTCCGG - Intergenic
1156428989 18:37050112-37050134 CTCCAGTAACAATCAGGCTCAGG - Intronic
1161822631 19:6539710-6539732 CTCCAAAAGAAGTGAGGGTAGGG + Intergenic
1163577406 19:18118700-18118722 CTCCAAGAGCGGTGAGGCTTTGG - Intronic
928286056 2:29990911-29990933 CTCCAACAGCAGCCAGGAAAGGG + Intergenic
929004047 2:37378500-37378522 GGCCAATGGCAGTCAGGCCAAGG - Intergenic
929992879 2:46804281-46804303 CTCCAAGAGCAGTCAGGCCGGGG + Intergenic
932095266 2:68841908-68841930 CACCAATAGCAGTGAGACTTTGG - Intergenic
932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG + Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
934933921 2:98451087-98451109 TTCCAATCCCAGACAGGCTATGG - Intronic
939829367 2:147053851-147053873 CGCCAAGAGGAGTCAGGCTGGGG + Intergenic
941220086 2:162767485-162767507 CTCCAATAGCAGTAAAACTATGG - Intronic
1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG + Intergenic
1174226773 20:49006968-49006990 CTCCAATGGCAGGCCGGCCACGG - Intronic
1176078604 20:63260530-63260552 CTCCAAAAGCAGAGAGGCCAAGG - Intronic
1180122990 21:45766310-45766332 CTCCAAAAGCAGTCATACTAGGG - Intronic
1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG + Exonic
1184882880 22:47322575-47322597 CTCCTATAGCTGGCAGGCTGTGG + Intergenic
952644384 3:35638875-35638897 CTCCAAGAGCGCTGAGGCTACGG + Intergenic
955567808 3:60268237-60268259 CTCCTATAGCATTTAGGCTGAGG + Intronic
956040422 3:65139519-65139541 CTCCAGTAGCTGTCAGGGTTGGG - Intergenic
959952978 3:112201946-112201968 CTCTAAGATCTGTCAGGCTATGG - Intronic
962977542 3:140458660-140458682 CTATAATAGTACTCAGGCTAAGG - Intronic
964581291 3:158241415-158241437 CTCCAGTAGCACTCTGGCTGGGG + Intronic
973534903 4:51871590-51871612 TTCCAATAGCAGTCACGGTTTGG - Intronic
977505302 4:97894797-97894819 CAACAATAGCTGTCAGCCTAAGG + Intronic
978892137 4:113842663-113842685 GTCCAAAAGCGGTCAGGCTGGGG + Intergenic
985502086 5:254654-254676 CTCCGACAGCAGTCGGGCTTCGG + Intronic
985817247 5:2135976-2135998 CTCCAACGGCTGTCAGGCTCAGG - Intergenic
986235425 5:5905264-5905286 ATCCTATACCAGTCAGGATAGGG + Intergenic
993634514 5:90327154-90327176 CTCCAATTGCTCTCAGGCTCAGG - Intergenic
1000005733 5:157182808-157182830 CACAAATAGCAGTTGGGCTAAGG - Intronic
1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG + Intronic
1005268482 6:24138345-24138367 CCCCAAAATCAATCAGGCTATGG + Intronic
1006526520 6:34610370-34610392 ATCCAATAGCAGGCAGCCTGAGG + Intronic
1013190195 6:107796307-107796329 CTCCAATTTCGGTCAGGATATGG - Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014141815 6:117952386-117952408 ATCCTTTAGCATTCAGGCTATGG - Intronic
1015631890 6:135239458-135239480 CTCCCAAAGCAGTCAGGCATTGG + Intergenic
1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG + Intergenic
1030325274 7:108212085-108212107 CTCCAATAGCAGCCTGGAGATGG + Intronic
1035825435 8:2639809-2639831 CTCCAAAACCAGTCAGACTGGGG - Intergenic
1039656331 8:39412027-39412049 CATCAATGGCAGTCAGGCAATGG + Intergenic
1042963958 8:74330997-74331019 TTCCAATAGCATTCATGCTGAGG + Intronic
1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG + Intergenic
1046842938 8:118880990-118881012 CTCCAATAGCTGATAGACTAAGG - Intergenic
1050616592 9:7407657-7407679 CTTCCATATCAGTCAGGGTAGGG + Intergenic
1051175102 9:14352727-14352749 CTCCAATAACAGACAGGGAAAGG + Intronic
1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG + Intergenic
1188481208 X:30638681-30638703 CTCCTAATACAGTCAGGCTACGG + Intergenic
1194521374 X:94922305-94922327 CTTCAATAGCATTTAGGTTAAGG + Intergenic