ID: 1013552010

View in Genome Browser
Species Human (GRCh38)
Location 6:111217107-111217129
Sequence GCTATTGGAGGGCACCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013552003_1013552010 -7 Left 1013552003 6:111217091-111217113 CCTCCCTAGCCTGACTGCTATTG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1013552010 6:111217107-111217129 GCTATTGGAGGGCACCCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1013552005_1013552010 -10 Left 1013552005 6:111217094-111217116 CCCTAGCCTGACTGCTATTGGAG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1013552010 6:111217107-111217129 GCTATTGGAGGGCACCCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1013552002_1013552010 -3 Left 1013552002 6:111217087-111217109 CCTTCCTCCCTAGCCTGACTGCT 0: 1
1: 1
2: 2
3: 40
4: 418
Right 1013552010 6:111217107-111217129 GCTATTGGAGGGCACCCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013552010 Original CRISPR GCTATTGGAGGGCACCCTCC AGG Intronic
900960114 1:5913656-5913678 CCTCTTGCAGGGCCCCCTCCAGG - Intronic
922561859 1:226575414-226575436 GGGATTGGAGGGCAGCCTGCTGG - Intronic
1063472490 10:6299370-6299392 ACTATGGGATGCCACCCTCCTGG - Intergenic
1067943707 10:50677502-50677524 ACTATGGAAGGGCACCTTCCAGG - Intergenic
1069704724 10:70451191-70451213 GGGAGGGGAGGGCACCCTCCTGG - Intergenic
1070865194 10:79704374-79704396 ACTATGGAAGGGCACCTTCCAGG - Intronic
1070878985 10:79842505-79842527 ACTATGGAAGGGCACCTTCCAGG - Intronic
1071632092 10:87226595-87226617 ACTATGGAAGGGCACCTTCCAGG - Intronic
1071645545 10:87358814-87358836 ACTATGGAAGGGCACCTTCCAGG - Intronic
1079568306 11:21910554-21910576 GGTATTGGTGAGCACCCTCATGG - Intergenic
1083668490 11:64287906-64287928 GCTAGTGGAGGGCGCCCGCCTGG - Exonic
1083683038 11:64359967-64359989 GGTTTTGCTGGGCACCCTCCCGG + Intronic
1084276941 11:68057077-68057099 GGAATTGGAGGGCACCCATCTGG + Intronic
1084704149 11:70806216-70806238 GCCATTGGAGGGCAGCATGCCGG - Intronic
1088681837 11:112250044-112250066 CTTACTGGAAGGCACCCTCCAGG - Intronic
1089110003 11:116048044-116048066 GTTATTTGAGTGCACACTCCAGG - Intergenic
1091220569 11:133927840-133927862 GATCCTGGAGGGCACCCACCAGG - Intronic
1101597879 12:106183371-106183393 GTTATGTGAGGGCAGCCTCCTGG - Intergenic
1102438028 12:112940337-112940359 GCTCCTGGAGGGCTCCATCCTGG + Intronic
1104243367 12:127013455-127013477 TCTATTGCAGTGCACTCTCCTGG - Intergenic
1105547121 13:21359102-21359124 GGTATCGGAGGGCCCCCTCAAGG + Intergenic
1107450090 13:40500435-40500457 GCATTTGGAGGGCAGCCTGCAGG - Intergenic
1109227943 13:59719535-59719557 GCTATTGGAGAACACATTCCAGG + Intronic
1113566453 13:111322403-111322425 GCCCTTGGGGGCCACCCTCCTGG + Intronic
1119478307 14:74944472-74944494 GCTATTGTAGAACACTCTCCAGG - Intronic
1119744878 14:77037074-77037096 GCCCTTGGAGGGCCTCCTCCTGG + Intergenic
1120685356 14:87531069-87531091 GCTGTTGGAGGTCAGACTCCAGG + Intergenic
1121090045 14:91174852-91174874 GGAATTGGAGGGCACCCAGCTGG + Intronic
1121121158 14:91376710-91376732 CCCATGGGAGGGCACCATCCAGG - Intronic
1121327194 14:93028051-93028073 GCTGTGGGAGAGCAGCCTCCGGG - Intronic
1128236519 15:66071294-66071316 ACTCTTGGAGGGCAGACTCCAGG - Intronic
1129780041 15:78264264-78264286 GTTGTCGGAGGGCGCCCTCCAGG + Exonic
1130651274 15:85763451-85763473 GCTGTTGGAGGGCGCCCACTAGG - Intronic
1131345672 15:91645899-91645921 GTAAAAGGAGGGCACCCTCCTGG + Intergenic
1131363930 15:91821321-91821343 GCTATGTGAGGGCACCATCTTGG + Intergenic
1133750103 16:8718580-8718602 GGAAATGGAGGGCACCCTCCAGG + Intronic
1133910332 16:10060066-10060088 GCTCTTGATGGGCAGCCTCCAGG - Intronic
1134841277 16:17403939-17403961 GCTAGTGGATGGCTCCCACCTGG - Intronic
1137033256 16:35544208-35544230 GGGATTGGGGGGCACCCTACTGG - Intergenic
1141540867 16:84720250-84720272 GCTACTGGAGGCCACCCGCCAGG - Intronic
1142661956 17:1436763-1436785 GCTGTGGGTGGGAACCCTCCTGG + Exonic
1147367175 17:39966567-39966589 GCTCTTGGAGGCAACCCTTCTGG + Intronic
1152742131 17:82023015-82023037 GCTGCTGGAGGGCGCGCTCCGGG - Intronic
1153499798 18:5736813-5736835 GGTATTGGAGGGCAGCAGCCTGG + Intergenic
1158963884 18:62607300-62607322 GCTAGTGCAGGGCTCCCTCCTGG - Intergenic
1160782781 19:885207-885229 CCTGTGGGAGGGCACCATCCGGG - Intronic
1164945333 19:32288487-32288509 GCAATGAGAGGGCTCCCTCCAGG - Intergenic
925418165 2:3688177-3688199 GGCATTGGAGGGCCCCCTCAAGG - Intronic
929627233 2:43421824-43421846 GCTCTTAAATGGCACCCTCCAGG - Intronic
936091799 2:109506353-109506375 GCTAGTGGTGCTCACCCTCCTGG - Intergenic
937086233 2:119173775-119173797 GCTCTTGAAGGGCTCCCACCTGG + Intergenic
938026851 2:127956797-127956819 TGAATTGGAGGGCACCCACCTGG + Intronic
945101305 2:206264408-206264430 TCTCTGGGAGGACACCCTCCAGG - Intergenic
947953925 2:234171429-234171451 GCTGTTGAAATGCACCCTCCCGG - Intergenic
1169383432 20:5127695-5127717 GGTGTTGGAGGGCGTCCTCCCGG + Intronic
1179781180 21:43702120-43702142 GCCACTGGAGAGCACCCACCAGG + Intergenic
1181085977 22:20439504-20439526 GGGATTGGGGGGCACCATCCAGG - Intronic
1184362209 22:44025238-44025260 GCTATGGGAGGGCTCCTTCCCGG - Intronic
1185009538 22:48305498-48305520 GCTGTTGGAGGCCACCCACATGG - Intergenic
949592775 3:5510899-5510921 CCAATTGGATGGCACTCTCCTGG - Intergenic
949702679 3:6777175-6777197 GCTGGTGGAGGGAGCCCTCCGGG - Intronic
953091032 3:39726275-39726297 GCTCATGGAGGCCACCCACCTGG + Intergenic
953389463 3:42526103-42526125 GCTAGAGGAGGGCAGACTCCAGG - Intronic
954997534 3:54895416-54895438 GCCCTTCGAGGACACCCTCCAGG - Intronic
963960796 3:151306538-151306560 GCTATGGGAGGACAACATCCAGG + Intronic
971188364 4:24402783-24402805 GCTATTTGTGGGCAGCCTCAAGG - Intergenic
972184301 4:36510087-36510109 GTTATTGGAGGTCACGCTTCAGG - Intergenic
978482705 4:109212421-109212443 GCTCTTGGAGGGCTCCCTTTTGG - Intronic
979980540 4:127249159-127249181 GCTCCTTGAGGGCACCCTGCTGG - Intergenic
980775831 4:137434997-137435019 GCTATTGGAAGGCAGCATCTTGG - Intergenic
981749099 4:148076331-148076353 GCTGTTTGAGGACACACTCCTGG - Intergenic
990622847 5:57578980-57579002 GCTGTTGGTCTGCACCCTCCTGG + Intergenic
1001709667 5:173768114-173768136 CCTCCTGGAGGGCACCCTCTGGG - Intergenic
1002942584 6:1731373-1731395 GTTATTGGAGGACACCCTTTTGG - Intronic
1003404558 6:5817611-5817633 GGTATTGGAGGGCCCCCTCAAGG - Intergenic
1006609836 6:35287725-35287747 GCCATCGGAGAGCACCATCCTGG + Exonic
1013552010 6:111217107-111217129 GCTATTGGAGGGCACCCTCCAGG + Intronic
1019437822 7:1031005-1031027 GCAGTGGGAGGGCTCCCTCCTGG - Intronic
1019527132 7:1485433-1485455 GCTTTCGGAGGGCAGCCTGCGGG - Exonic
1019912619 7:4109968-4109990 GAACTTGGAGGGCACCCTGCAGG + Intronic
1031586708 7:123539197-123539219 GATATAGGGGGGCACCCTACTGG - Exonic
1034049231 7:147964470-147964492 GCTTTTGCAGGGCAGTCTCCAGG - Intronic
1035270156 7:157715026-157715048 GCTTTTGGAGGCCAGCTTCCTGG + Intronic
1037669915 8:21005637-21005659 GCTTTCCAAGGGCACCCTCCTGG - Intergenic
1038030043 8:23629859-23629881 GCTCTTAGAGGACACCCTCTGGG + Intergenic
1040617924 8:49058363-49058385 TCTACTGGAGGGCACTCTGCTGG + Intronic
1043505010 8:80893902-80893924 GCTATTGGAGGAGCCCATCCAGG + Intergenic
1044286546 8:90416977-90416999 ACTATTGCAAGACACCCTCCTGG + Intergenic
1050477446 9:6054632-6054654 GCTATTGGACGGCGGCCCCCTGG - Intergenic
1057355510 9:94328209-94328231 ACTATGGAAGGGCACCTTCCAGG + Intronic
1057652245 9:96929413-96929435 ACTATGGAAGGGCACCTTCCAGG - Intronic
1059603849 9:115811572-115811594 GCCATTGGAGGGGACCCTGATGG + Intergenic
1060195771 9:121622448-121622470 GGTATTGGAGGTCCCCATCCTGG - Intronic
1060435072 9:123586221-123586243 GCCATTGGAGAGAAGCCTCCAGG + Intronic
1062382946 9:136296370-136296392 GCTTGTCGAGGCCACCCTCCAGG - Intronic
1186349423 X:8727812-8727834 GCCATTTCAGGGCTCCCTCCAGG + Intronic
1187581249 X:20609838-20609860 GCAATTGGAAGGCACTCTTCTGG + Intergenic
1201266655 Y:12213310-12213332 CCTCTTGGAGGGCACACTTCTGG + Intergenic