ID: 1013552015

View in Genome Browser
Species Human (GRCh38)
Location 6:111217144-111217166
Sequence CAGCCTGCTGCTGCCCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013552012_1013552015 -1 Left 1013552012 6:111217122-111217144 CCTCCAGGCACAGTTCTGTTCAC 0: 1
1: 0
2: 2
3: 16
4: 186
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data
1013552003_1013552015 30 Left 1013552003 6:111217091-111217113 CCTCCCTAGCCTGACTGCTATTG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data
1013552006_1013552015 26 Left 1013552006 6:111217095-111217117 CCTAGCCTGACTGCTATTGGAGG 0: 1
1: 0
2: 1
3: 8
4: 295
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data
1013552011_1013552015 0 Left 1013552011 6:111217121-111217143 CCCTCCAGGCACAGTTCTGTTCA 0: 1
1: 0
2: 2
3: 26
4: 211
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data
1013552005_1013552015 27 Left 1013552005 6:111217094-111217116 CCCTAGCCTGACTGCTATTGGAG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data
1013552009_1013552015 21 Left 1013552009 6:111217100-111217122 CCTGACTGCTATTGGAGGGCACC 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data
1013552013_1013552015 -4 Left 1013552013 6:111217125-111217147 CCAGGCACAGTTCTGTTCACAGC 0: 1
1: 0
2: 1
3: 23
4: 210
Right 1013552015 6:111217144-111217166 CAGCCTGCTGCTGCCCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013552015 Original CRISPR CAGCCTGCTGCTGCCCCCGT GGG Intronic
No off target data available for this crispr