ID: 1013556230

View in Genome Browser
Species Human (GRCh38)
Location 6:111259651-111259673
Sequence CCCGGTCCCACCGCTCTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013556230_1013556239 28 Left 1013556230 6:111259651-111259673 CCTGGCAGAGCGGTGGGACCGGG 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1013556239 6:111259702-111259724 TGCTGTGTGCCTCCTTCCTGGGG 0: 1
1: 0
2: 4
3: 42
4: 478
1013556230_1013556233 -8 Left 1013556230 6:111259651-111259673 CCTGGCAGAGCGGTGGGACCGGG 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1013556233 6:111259666-111259688 GGACCGGGAGCAAGCTGCGGTGG 0: 1
1: 0
2: 0
3: 15
4: 125
1013556230_1013556238 27 Left 1013556230 6:111259651-111259673 CCTGGCAGAGCGGTGGGACCGGG 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1013556238 6:111259701-111259723 ATGCTGTGTGCCTCCTTCCTGGG 0: 1
1: 0
2: 2
3: 31
4: 354
1013556230_1013556237 26 Left 1013556230 6:111259651-111259673 CCTGGCAGAGCGGTGGGACCGGG 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1013556237 6:111259700-111259722 GATGCTGTGTGCCTCCTTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013556230 Original CRISPR CCCGGTCCCACCGCTCTGCC AGG (reversed) Exonic
900110183 1:1001965-1001987 CCCGGGCCCAGCGCTCAGGCCGG - Intergenic
900165118 1:1241413-1241435 CCCGTCCCCACCTCTCTCCCTGG - Intergenic
900187610 1:1339682-1339704 CATGGTCCCACCTCCCTGCCTGG + Intronic
900371805 1:2335540-2335562 CCCGGTGCCACCCCTGTCCCAGG + Intronic
900371836 1:2335690-2335712 CCCGCTCCCACCCGCCTGCCAGG - Intronic
900601045 1:3502726-3502748 CCAGCACCCACGGCTCTGCCAGG - Intronic
901186186 1:7374966-7374988 CCCAGCCCCACTGCTCTACCAGG - Intronic
904499873 1:30907836-30907858 CCCGGGCCCACTGCCCTGGCCGG + Intronic
905364432 1:37441612-37441634 CCTGTACCCACCGCTATGCCGGG - Intergenic
905664351 1:39753534-39753556 CCTGGGCCCACAGCTGTGCCTGG - Intronic
907300412 1:53483334-53483356 CCGGGTCACACCGCTCTGGATGG - Intergenic
912682557 1:111738654-111738676 CCTGGGCCCCCAGCTCTGCCGGG - Intronic
912953179 1:114134645-114134667 TCTGTTCCCACCTCTCTGCCTGG - Intronic
914230913 1:145764437-145764459 CTCGGCCCCACCGCCCTGTCTGG + Intronic
915530213 1:156498919-156498941 CCAGCTCCCACGGCCCTGCCTGG - Intronic
916100658 1:161390526-161390548 CCCGGTCCAGGCGCGCTGCCAGG - Intergenic
917366793 1:174240387-174240409 CCGGTTCCCACCGCCATGCCTGG + Intronic
919820330 1:201468418-201468440 CCCGGTCCCGAGGCTCTGCCGGG + Exonic
920632907 1:207669707-207669729 CCCAGACCCGCCGCCCTGCCAGG - Intronic
1065004170 10:21364546-21364568 GCCTGTCCCACCGGTCTGCCAGG - Intergenic
1067343558 10:45422404-45422426 CCAGGACCCAGTGCTCTGCCTGG - Intronic
1070398440 10:76032595-76032617 CTCGTTCCCAGGGCTCTGCCTGG - Intronic
1072641023 10:97211429-97211451 CCCAATCCCACCTTTCTGCCTGG + Intronic
1073625800 10:105095526-105095548 CCCAGGCCCACCTATCTGCCTGG - Intronic
1076142352 10:128089716-128089738 CCCAGTCCCACCCCACTGTCAGG + Intergenic
1076673264 10:132134652-132134674 CCAGCTCCCAGCCCTCTGCCTGG - Intronic
1077419853 11:2445053-2445075 CCCGGTGCCGCCGCTCGGGCCGG + Exonic
1077502220 11:2914542-2914564 TCAGGTCCCACCACTGTGCCAGG - Intronic
1081705523 11:45180535-45180557 CCCTCTCCCACCGCCCCGCCCGG + Intronic
1085044810 11:73346702-73346724 CCCAGGCCCTCCACTCTGCCAGG - Intronic
1085524562 11:77156808-77156830 CCCGCTCCCGCCCCACTGCCTGG - Intronic
1088279530 11:108121984-108122006 CCCGATCCCACCGCTCAGGCCGG - Intronic
1090194087 11:124800205-124800227 CCCGAGCCCGCCGCACTGCCCGG + Exonic
1091616409 12:2053760-2053782 CCCGGTCCCGCCGGGCTCCCGGG - Intronic
1094512405 12:31104388-31104410 TCCTGTCCCACAGCCCTGCCTGG + Exonic
1095950286 12:47778075-47778097 CCGGGATCCACCGCCCTGCCCGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1102152748 12:110699926-110699948 CAGGGACCCCCCGCTCTGCCAGG + Intronic
1103963447 12:124623362-124623384 CCCCGTCCCACCTCTCCTCCAGG - Intergenic
1104628253 12:130377495-130377517 GACGGCCCCACCTCTCTGCCTGG - Intergenic
1104759715 12:131289647-131289669 CCCGGCCCCACCCCTGAGCCCGG + Intergenic
1104807053 12:131596359-131596381 CCAAGTCCCATCGCTCTTCCTGG + Intergenic
1104902365 12:132196443-132196465 CCCGGTCCCACCTCTTTCCCAGG - Exonic
1104932219 12:132345773-132345795 CCCGCGCCAACCCCTCTGCCCGG + Intergenic
1105800260 13:23896865-23896887 CCCGGTCACAATGGTCTGCCTGG - Exonic
1105848754 13:24316103-24316125 CCCGGTCACAATGGTCTGCCTGG + Exonic
1106077785 13:26475875-26475897 CCCCATCCCACCTCTCTTCCAGG - Intergenic
1107432513 13:40352596-40352618 CCCTCTCTCACCTCTCTGCCAGG + Intergenic
1110706251 13:78603636-78603658 CGCGGCCCCACCGCGCTGACAGG + Intergenic
1113459652 13:110472988-110473010 CCAGGTCCCATCGGCCTGCCAGG + Exonic
1114189517 14:20429967-20429989 CCCGGGCCCACCACACTGCTCGG + Exonic
1114485884 14:23061481-23061503 CCTGCTCCCGCTGCTCTGCCCGG + Exonic
1114736681 14:25049867-25049889 CCCGGTCCTACCGTGCAGCCTGG + Exonic
1117224135 14:53637627-53637649 CCCAGTCCCTCCCCTCTGCAGGG + Intergenic
1119405345 14:74395309-74395331 CCAGGTCCAGCAGCTCTGCCAGG + Intergenic
1120611122 14:86643036-86643058 CCAGGTTCCACCACTCTGCATGG - Intergenic
1130015856 15:80185906-80185928 CCCGGGCCCACCCCACAGCCAGG - Intronic
1130040796 15:80404227-80404249 CGCGGTGCTACCGCTCTGACCGG + Intergenic
1130762140 15:86831892-86831914 CCCTGTAGCACCCCTCTGCCTGG + Intronic
1131260364 15:90884563-90884585 CCAGCTCCCACCGCTCCTCCAGG - Intronic
1132766739 16:1538169-1538191 CACAGACCCACCGCCCTGCCAGG - Intronic
1132956451 16:2596852-2596874 CCTGGCCCCTCTGCTCTGCCTGG - Intronic
1134053629 16:11155492-11155514 CCATGTCCCACAGGTCTGCCAGG + Intronic
1134055789 16:11169003-11169025 CCCTGGCCCACCCCGCTGCCTGG - Intronic
1135995442 16:27244447-27244469 CCAGGTCCCAGCACTCAGCCTGG + Intronic
1136110817 16:28062947-28062969 CCAGCTCCCAGCGCTCCGCCTGG - Intronic
1136570411 16:31093421-31093443 CCCCACCCCACCCCTCTGCCAGG - Exonic
1138575361 16:57904089-57904111 CCCCCTCCCAACGCCCTGCCAGG - Intronic
1138578188 16:57922270-57922292 CCCGGGCCCTGGGCTCTGCCTGG - Intronic
1139581714 16:67877737-67877759 CCAGGTCCCACACCTCAGCCTGG - Exonic
1141523167 16:84594851-84594873 CCCCCTCCCACGGCTCTGGCTGG + Intronic
1142348713 16:89570212-89570234 CCCAGTGCCACCCCTCTGCTTGG - Intergenic
1143519707 17:7438320-7438342 GCCGCTGCCGCCGCTCTGCCTGG + Intronic
1143681288 17:8477770-8477792 CCCGCTCCCTGCCCTCTGCCTGG - Intronic
1145747702 17:27332468-27332490 CCCTGCCCCACCCCTCTGACTGG - Intergenic
1146006615 17:29164516-29164538 CCCGGTCCCAGCTTTCTCCCAGG - Intronic
1146553079 17:33798879-33798901 CCAGGGCCCACAGCTGTGCCAGG - Intronic
1147662648 17:42125237-42125259 CCCGCTCCCACCTCCCTGCTGGG - Intronic
1148048681 17:44758990-44759012 CCCGGCCCCGCCGCCCCGCCGGG + Intergenic
1148131392 17:45264507-45264529 CCTGGTCCCACTGCTGAGCCGGG + Exonic
1148582416 17:48752912-48752934 CCCGGCACCCCGGCTCTGCCAGG - Intergenic
1148795461 17:50194737-50194759 CCCGGACCCACTGGCCTGCCCGG - Exonic
1150143507 17:62749830-62749852 CCCGGTGCCACCGCTCAGGGCGG + Intronic
1150429524 17:65104007-65104029 CCCTGTCCAGCGGCTCTGCCTGG + Intergenic
1151195856 17:72430745-72430767 CCCTGTCCCACCGCTGTCCGCGG - Intergenic
1151477147 17:74350599-74350621 CCAGGCCCCACCCCTGTGCCTGG + Intronic
1152236171 17:79140024-79140046 CCTGGTCCCGCGGCCCTGCCAGG + Intronic
1152322032 17:79613079-79613101 CTCGGGCACACAGCTCTGCCAGG - Intergenic
1152460604 17:80440086-80440108 CCCGCTCCCAGCTCTCTGTCAGG - Intergenic
1152741316 17:82019723-82019745 CCCTCACCCACCGCTCTGGCTGG + Intronic
1157300843 18:46477952-46477974 CACTCTCCCACCTCTCTGCCAGG - Exonic
1158649444 18:59273032-59273054 CCCGGGCGCCCCGCTCCGCCGGG + Exonic
1158976566 18:62715933-62715955 CCGGCACCCCCCGCTCTGCCCGG - Exonic
1159152577 18:64538810-64538832 CCCAGTCCCACCTTGCTGCCTGG - Intergenic
1159511194 18:69400656-69400678 CCCGGTCCCTCAGCGCTCCCCGG - Intergenic
1160744733 19:705536-705558 GCCTGTCCCACCGCCCTGCCTGG + Intergenic
1160927946 19:1555992-1556014 CCCGGCCCCACTGCTGCGCCGGG + Exonic
1160944676 19:1636009-1636031 GCCTGTCCCACCGCCCTGCCTGG + Intronic
1161478321 19:4498410-4498432 CCCGCTGCCACCTCCCTGCCAGG + Intronic
1161983754 19:7643369-7643391 CCAGGTCCCACCTCTCTCCAAGG - Intronic
1162562297 19:11423767-11423789 CCCTGTCTCCCCTCTCTGCCAGG - Intronic
1162797334 19:13093804-13093826 CCCTGACCCACCACTTTGCCAGG + Intronic
1162915536 19:13872824-13872846 CACGTTCCCACCCCTCTGTCTGG - Intronic
1163500046 19:17670992-17671014 CCCAGTCCCTCCTCTATGCCTGG + Intronic
1163692772 19:18746253-18746275 CCTGGCCCCACTGCCCTGCCAGG - Intronic
1165996680 19:39848654-39848676 CCCCCTCCCACCTCTCTGCCTGG - Intergenic
1166137501 19:40786317-40786339 CCTGGCCCCAACCCTCTGCCTGG - Intronic
1166327781 19:42061861-42061883 CCCTGTCCCCTCGCCCTGCCCGG + Intronic
1166389634 19:42401851-42401873 CCCCGTCTCCCCGCTCGGCCCGG + Exonic
1166795750 19:45424404-45424426 CCCCATCCCACGGCTCTCCCGGG - Intronic
1167134451 19:47608740-47608762 CCGGGTCCCGCCGCTCGGCCTGG + Intronic
1168049911 19:53821729-53821751 CTCGCTCCCACCACTCTGGCTGG - Intronic
926008879 2:9393132-9393154 CCGGGGCCCTCAGCTCTGCCCGG - Intronic
932728427 2:74199284-74199306 CGCGCTGCCTCCGCTCTGCCAGG + Intronic
933728038 2:85437567-85437589 CCCTGTCCCGCAGCTCCGCCTGG - Intergenic
936104764 2:109614552-109614574 CCCGGCCCCCGCGCTCCGCCAGG - Exonic
937904489 2:127046212-127046234 CCTGGGCCCTCTGCTCTGCCCGG + Intergenic
942763441 2:179427264-179427286 CACTGTCCCACCTCTCTGCTGGG + Intergenic
944722807 2:202440782-202440804 CCCGGTCTCCCCGGTCTCCCCGG - Intronic
946431093 2:219627766-219627788 CCCGGGTCCCCCGCCCTGCCCGG - Intronic
947729708 2:232421064-232421086 CCCGCTGCCGCCGCGCTGCCAGG - Intergenic
948856960 2:240734781-240734803 CCCGCTCCCGCTGCGCTGCCCGG - Intronic
948859027 2:240743952-240743974 CCCGTTCCCGCCCCTCTGCAAGG - Exonic
1171960869 20:31493134-31493156 CCCAGTCCCACTGCGCTCCCTGG + Intergenic
1173042142 20:39474693-39474715 CCCGGTCCCACCCCACTCACAGG - Intergenic
1175553450 20:59831625-59831647 CCCCGCCCCACCCCTCTGCAGGG + Intronic
1175806248 20:61830721-61830743 CCCGCTCCTGCCGCTCTGCAGGG - Intronic
1175912812 20:62412819-62412841 CCTGGACCCACCTCGCTGCCTGG + Exonic
1175928225 20:62481107-62481129 CCGGGCCCCACAGCCCTGCCAGG - Intergenic
1177835708 21:26184401-26184423 CCCCTTCTCACAGCTCTGCCAGG + Intergenic
1179937506 21:44614547-44614569 CCCGGCCACACGGCCCTGCCAGG - Intronic
1180960050 22:19758496-19758518 CCGAGGCCCGCCGCTCTGCCTGG - Intronic
1182866799 22:33611176-33611198 CCCCTTCCCACAGCTCTGCTAGG - Intronic
1183494247 22:38133398-38133420 CCTGTTCCCAAGGCTCTGCCAGG - Intronic
1183601633 22:38843632-38843654 GCCGGGCCCCCCGCGCTGCCCGG - Exonic
1183736912 22:39649393-39649415 CCCAGGCCCACAGGTCTGCCTGG - Intronic
1183831951 22:40422928-40422950 CCCAGCCCCACACCTCTGCCTGG - Intronic
1183949480 22:41344663-41344685 CCTTGTCCCATCTCTCTGCCAGG - Intronic
1184874639 22:47266382-47266404 CCTGGTCCTATTGCTCTGCCAGG - Intergenic
949110160 3:250545-250567 CCCGTTCCCACTGCTGTACCAGG - Intronic
953661703 3:44895510-44895532 CCCCTCCCCACAGCTCTGCCTGG - Intronic
954795824 3:53161032-53161054 CCCGGTCCCTCTGCCCTGCCTGG - Intronic
956405198 3:68921248-68921270 CCCAGTCCATCCGCTCTGCTTGG + Intronic
960047537 3:113212159-113212181 CCGGGTCCCAGCGCTCGGCCGGG + Intronic
961479198 3:127168605-127168627 CCCGGTCCCCCTGCTGTCCCCGG - Intergenic
961523906 3:127484419-127484441 CCCGGTGCCACTGCCCTGCATGG + Intergenic
966910557 3:184557249-184557271 CGCTGTCCCCCAGCTCTGCCGGG - Intronic
969584017 4:8081523-8081545 CCTGCTCCACCCGCTCTGCCAGG - Intronic
970333182 4:15004352-15004374 CCCGGTCCCGCGGCGCGGCCAGG - Intronic
972762364 4:42119439-42119461 CTCCTTCCCACCCCTCTGCCTGG + Intronic
973739180 4:53902563-53902585 GCCAGTCCCACCACACTGCCTGG + Intronic
980920773 4:139083852-139083874 CCCGCTGCCAGCGCTCAGCCCGG + Intronic
981597612 4:146445398-146445420 GCCGGTCGCACCTCTCTGGCGGG + Intronic
982711481 4:158762431-158762453 CCCCATCCCACAGTTCTGCCTGG - Intergenic
985544304 5:501427-501449 CACCGCCCCACCGCTCAGCCAGG - Intronic
985727106 5:1522385-1522407 CCCTCTGCCGCCGCTCTGCCTGG - Intronic
986464598 5:8008522-8008544 TCTGGACCCACCCCTCTGCCAGG - Intergenic
987033463 5:13996894-13996916 CCCAACCCCACCGTTCTGCCAGG + Intergenic
988180592 5:27786532-27786554 CCCGCCCCCACAGCTCTACCCGG + Intergenic
990185293 5:53204343-53204365 CCCAATACCTCCGCTCTGCCAGG - Intergenic
991690202 5:69218045-69218067 GCCGGACCCACCTCACTGCCCGG - Intronic
992179716 5:74184183-74184205 CCCGGTCCCACCCCACAGCCAGG - Intergenic
993903078 5:93597210-93597232 CCCGGTTCCACGGCTCCCCCTGG - Intergenic
995784794 5:115816593-115816615 CCCGGATCCACTGCGCTGCCAGG - Exonic
997691716 5:135831884-135831906 CCCTGTGCCACTGCCCTGCCTGG - Intergenic
999655611 5:153807754-153807776 CCCTGCCCCTCCCCTCTGCCTGG + Intronic
1000262360 5:159600156-159600178 CCTGTTCCCACAGCTCTGCTGGG + Intergenic
1001715888 5:173815774-173815796 CCAGGTCCCACCTCACTGCCGGG - Intergenic
1002565913 5:180113001-180113023 CCCGGTCCCTCCGTCCAGCCCGG - Intronic
1002565936 5:180113058-180113080 CCCGGTCCCTCCGTCCAGCCCGG - Intronic
1002566184 5:180113724-180113746 CCCGGTCCCTCCGTCCAGCCCGG - Intronic
1003330488 6:5124704-5124726 CCCTGACCCACCTCCCTGCCCGG + Intronic
1006147050 6:31965917-31965939 CCAGGCCCCTCCGCCCTGCCCGG - Exonic
1006351092 6:33521701-33521723 CCGGGTCCCCCAGCACTGCCGGG - Intergenic
1006839943 6:37022262-37022284 CCCGGACCCACTGCGGTGCCCGG - Exonic
1008602446 6:53109439-53109461 TTGGGTCCCACCCCTCTGCCAGG + Intergenic
1011517235 6:88166916-88166938 CGCGGTCCCAAAGCTCAGCCCGG - Intergenic
1013556230 6:111259651-111259673 CCCGGTCCCACCGCTCTGCCAGG - Exonic
1015935686 6:138404361-138404383 CCCGGTCCCTCCTCCCGGCCGGG - Exonic
1016597266 6:145815619-145815641 CCCGCCCCCACCCCTCTGTCGGG + Intergenic
1018203232 6:161414006-161414028 TCACGTCCCACCGCTCTGCCTGG - Intronic
1018247707 6:161838685-161838707 CCCCGTCCCACTGCACTGGCTGG + Intronic
1018644685 6:165936589-165936611 CCCATTCCCACCACCCTGCCTGG - Intronic
1019463695 7:1174969-1174991 CCCGCTCCCACCTCACTTCCAGG + Intergenic
1020080510 7:5283586-5283608 CCCGGGCCCACCGCCCTCCCCGG - Intronic
1022322774 7:29303011-29303033 CCCGGTCCCGCCCATCTTCCAGG + Intronic
1022561953 7:31358671-31358693 CCCGTTCCCTCGGCTCTTCCTGG + Intergenic
1022631828 7:32092602-32092624 CCAGATCCCACTGCTCAGCCAGG + Intronic
1024590721 7:50880213-50880235 CCCACACCCACTGCTCTGCCTGG - Intergenic
1025198407 7:56948593-56948615 CCCGGACCCACCGCCCTCCCCGG + Intergenic
1025673544 7:63628340-63628362 CCCGGACCCACCGCCCTCCCCGG - Intergenic
1026878465 7:73893499-73893521 GCCGGTCCCACTGCTGGGCCGGG + Intergenic
1029584702 7:101462900-101462922 CCCGGCCCCATCACTCTGCAAGG - Intronic
1029616825 7:101664543-101664565 CGCGGCCCCTCCCCTCTGCCTGG + Intergenic
1029626427 7:101722802-101722824 CCTCTTCCCACAGCTCTGCCTGG + Intergenic
1032121394 7:129159739-129159761 CCTTGTCCCACAGCACTGCCAGG - Intronic
1032525677 7:132577036-132577058 CCCGGCCCCAGGGCACTGCCCGG - Exonic
1033244203 7:139704789-139704811 CCCCGTCCCACCACTCTCCTCGG + Intronic
1033253328 7:139778197-139778219 CCCAGTCCCCCCGCGCTGCGCGG - Intronic
1037420447 8:18696147-18696169 TCCGGTCCCAGAGCTCTGCAAGG + Intronic
1037633495 8:20679046-20679068 CCCGGCCCCACCTCTCTTCTTGG + Intergenic
1041072076 8:54135294-54135316 CCGGGCCCCACCGCCCTGCAAGG - Exonic
1045219936 8:100188973-100188995 CCCCATACCACTGCTCTGCCAGG + Intronic
1045459028 8:102411591-102411613 CCCGCTCCCAGCAATCTGCCGGG + Intronic
1048988280 8:139747192-139747214 CCCGCCCCCACCGCTCTGTGTGG + Intronic
1049346022 8:142139097-142139119 CCCGGTTCCACCCCTCCTCCTGG - Intergenic
1049553634 8:143271868-143271890 CCTGGTCTCCCCGCTCTGCAAGG - Intronic
1049597564 8:143491760-143491782 CCCGGCCCCACAGCCCTGCACGG - Intronic
1056254839 9:84788579-84788601 TCCTGTCCCACTGTTCTGCCTGG - Intronic
1057081764 9:92178867-92178889 CCTGGTCCCTCCTCTCTACCTGG - Intergenic
1057229382 9:93310273-93310295 CATGGTCCCACAGCTCTGCGAGG + Intronic
1060810271 9:126607978-126608000 CCCAGCTCCACCCCTCTGCCTGG + Intergenic
1060983744 9:127808275-127808297 CTCGGTCCCTCAGCACTGCCAGG - Exonic
1061019120 9:128002558-128002580 CCCGCCCCCACTGCTTTGCCTGG + Intergenic
1061108971 9:128553099-128553121 CCCGGTCCCTTCCCTCGGCCGGG + Intronic
1061226269 9:129282810-129282832 TCCGATCCCACCGCCCTGCTAGG - Intergenic
1061236252 9:129344243-129344265 CCCGGTGCCACCCCCCTCCCGGG - Intergenic
1062037098 9:134387192-134387214 CCCGGCCGCTCCGCCCTGCCCGG + Intronic
1062432392 9:136531969-136531991 CCCAGTCCCAGCGCCCAGCCCGG + Intronic
1062694259 9:137865090-137865112 TCCTCTCCCACCCCTCTGCCAGG - Intronic
1062733199 9:138120633-138120655 CCCGGCCCCACAGCACTGCTTGG - Exonic
1203781901 EBV:105473-105495 CCCGCTGCCACCTCTCTGCCAGG - Intergenic
1193977701 X:88143071-88143093 CCCCATCCAACAGCTCTGCCTGG + Intergenic
1200162470 X:154016566-154016588 CCCGGTTCAGCCGCTTTGCCGGG - Exonic
1200208159 X:154332686-154332708 CGCTGTCCCACCGCCCTCCCTGG + Intergenic
1201357320 Y:13111700-13111722 CCTGGTTCCACTGCACTGCCAGG - Intergenic