ID: 1013558009

View in Genome Browser
Species Human (GRCh38)
Location 6:111276871-111276893
Sequence CAAGTCAAACAGGTTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013558009_1013558012 2 Left 1013558009 6:111276871-111276893 CCAGAGGAAACCTGTTTGACTTG No data
Right 1013558012 6:111276896-111276918 TAGATGCCATTGCCCTTATTGGG No data
1013558009_1013558015 14 Left 1013558009 6:111276871-111276893 CCAGAGGAAACCTGTTTGACTTG No data
Right 1013558015 6:111276908-111276930 CCCTTATTGGGCCTTGCCTCAGG No data
1013558009_1013558011 1 Left 1013558009 6:111276871-111276893 CCAGAGGAAACCTGTTTGACTTG No data
Right 1013558011 6:111276895-111276917 ATAGATGCCATTGCCCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013558009 Original CRISPR CAAGTCAAACAGGTTTCCTC TGG (reversed) Intergenic