ID: 1013558024

View in Genome Browser
Species Human (GRCh38)
Location 6:111276960-111276982
Sequence CAAGTCAAACAGGTTTCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013558024_1013558030 14 Left 1013558024 6:111276960-111276982 CCGGAGGAAACCTGTTTGACTTG No data
Right 1013558030 6:111276997-111277019 CCCTTATTGGGCCTTGCCTCAGG No data
1013558024_1013558027 2 Left 1013558024 6:111276960-111276982 CCGGAGGAAACCTGTTTGACTTG No data
Right 1013558027 6:111276985-111277007 TAGATGCCATTGCCCTTATTGGG No data
1013558024_1013558026 1 Left 1013558024 6:111276960-111276982 CCGGAGGAAACCTGTTTGACTTG No data
Right 1013558026 6:111276984-111277006 GTAGATGCCATTGCCCTTATTGG No data
1013558024_1013558032 23 Left 1013558024 6:111276960-111276982 CCGGAGGAAACCTGTTTGACTTG No data
Right 1013558032 6:111277006-111277028 GGCCTTGCCTCAGGAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013558024 Original CRISPR CAAGTCAAACAGGTTTCCTC CGG (reversed) Intergenic