ID: 1013558600

View in Genome Browser
Species Human (GRCh38)
Location 6:111282692-111282714
Sequence CTGGTTAAACAGTTCTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013558597_1013558600 22 Left 1013558597 6:111282647-111282669 CCACAGCCTTATTTTTATCTTGT No data
Right 1013558600 6:111282692-111282714 CTGGTTAAACAGTTCTAACTTGG No data
1013558598_1013558600 16 Left 1013558598 6:111282653-111282675 CCTTATTTTTATCTTGTTTAAAA No data
Right 1013558600 6:111282692-111282714 CTGGTTAAACAGTTCTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013558600 Original CRISPR CTGGTTAAACAGTTCTAACT TGG Intergenic
No off target data available for this crispr