ID: 1013564101

View in Genome Browser
Species Human (GRCh38)
Location 6:111339914-111339936
Sequence TTGACAAAGCATTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013564101_1013564107 18 Left 1013564101 6:111339914-111339936 CCATCCTCCTAATGCTTTGTCAA 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1013564107 6:111339955-111339977 CAAGTTTTGATCCGGAAAGGAGG No data
1013564101_1013564109 23 Left 1013564101 6:111339914-111339936 CCATCCTCCTAATGCTTTGTCAA 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1013564109 6:111339960-111339982 TTTGATCCGGAAAGGAGGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 218
1013564101_1013564106 15 Left 1013564101 6:111339914-111339936 CCATCCTCCTAATGCTTTGTCAA 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1013564106 6:111339952-111339974 ATACAAGTTTTGATCCGGAAAGG No data
1013564101_1013564108 22 Left 1013564101 6:111339914-111339936 CCATCCTCCTAATGCTTTGTCAA 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1013564108 6:111339959-111339981 TTTTGATCCGGAAAGGAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 190
1013564101_1013564105 10 Left 1013564101 6:111339914-111339936 CCATCCTCCTAATGCTTTGTCAA 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1013564105 6:111339947-111339969 AATAAATACAAGTTTTGATCCGG 0: 1
1: 0
2: 1
3: 37
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013564101 Original CRISPR TTGACAAAGCATTAGGAGGA TGG (reversed) Intronic
901645947 1:10716819-10716841 TTGAGAAAGCCTTTGGGGGATGG - Intronic
903294987 1:22338024-22338046 TTCCCAAAGCACTAGGAGGATGG - Intergenic
905332902 1:37219584-37219606 TTGACAAAGCATTTTTATGATGG - Intergenic
905813171 1:40927930-40927952 TTGCCAAGGCCTTGGGAGGAGGG + Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
910287269 1:85569647-85569669 TGGAAAAAGCATTTGCAGGATGG + Intronic
911882077 1:103252265-103252287 ATGAGACAGCATTAGGGGGATGG - Intergenic
912962901 1:114211696-114211718 ATGATAATGCATTAGGTGGATGG - Intergenic
913100953 1:115564964-115564986 TATAAAAAACATTAGGAGGAAGG + Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
915027072 1:152841179-152841201 TGCACTAAGCATTAGCAGGAAGG - Intergenic
916038274 1:160940769-160940791 TTGAAAAAGGATTAGGCGAATGG - Intergenic
916297745 1:163238580-163238602 TTTACAAAGCTTTAGGACCATGG - Intronic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
917863396 1:179170291-179170313 TTGAAAAAGTAGTAGGAGGTGGG - Intronic
920785908 1:209040944-209040966 GTGCCAAAGGATTAAGAGGAAGG - Intergenic
920985679 1:210886174-210886196 TGGACAAAGCTTTCAGAGGAAGG + Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
1063083849 10:2795619-2795641 TTGACAAAGCTTTAGCTAGATGG + Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063766775 10:9150826-9150848 TTGACATGGCATAAGAAGGATGG - Intergenic
1066400950 10:35075214-35075236 CTGACAAACCAATAGCAGGAAGG + Intronic
1066655075 10:37690594-37690616 TTGACAAACCTTTAGCAAGACGG + Intergenic
1067557423 10:47282618-47282640 TTGACACAGCAGGAGGTGGAAGG + Intergenic
1068940763 10:62678614-62678636 ATGGCAAAGGATTTGGAGGAGGG - Intergenic
1071476282 10:86028167-86028189 TTGACAAATAATTATGAGCAAGG + Intronic
1071588899 10:86852803-86852825 TTCACAAAGCCATATGAGGAGGG + Intronic
1071873113 10:89816634-89816656 TAGAGAAAGTATTAAGAGGAGGG - Intergenic
1071950076 10:90693172-90693194 TTGACAAAGAAAAAGGAAGATGG + Intergenic
1072230494 10:93410288-93410310 GTGACAAACCAGGAGGAGGAAGG - Intronic
1073570892 10:104580356-104580378 TTGACAAAGGAATGGGAGGCCGG - Intergenic
1075330091 10:121567611-121567633 TTGCTTAAGCATTAGGAAGAAGG + Intronic
1076271934 10:129161295-129161317 TTGACAAAGCCTGAGGGGAAGGG - Intergenic
1076659115 10:132043695-132043717 TGGACACAGCATGACGAGGAGGG + Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1079507398 11:21168934-21168956 CTGACAAATAATTAGGAAGAAGG - Intronic
1079541626 11:21582971-21582993 GTGAGAAAGCAGTAGCAGGATGG - Intergenic
1079939817 11:26665557-26665579 TTGAAAAAGGAATTGGAGGATGG + Intergenic
1082163334 11:48908852-48908874 TTGATAAGGCATAAGGAAGAGGG - Intergenic
1084668062 11:70587274-70587296 TAGAGAAAGCATTTAGAGGAGGG - Intronic
1086382061 11:86265012-86265034 TTGACAAGGTATTCGAAGGAAGG - Intronic
1087008765 11:93494041-93494063 TTGACAAAGCAGTAAGGTGAAGG - Intronic
1087365857 11:97217862-97217884 TTAACAAATGAATAGGAGGAGGG - Intergenic
1088348677 11:108860450-108860472 TTGACTAAGTGTTAGGAGTATGG - Intronic
1091985226 12:4905437-4905459 TTGAGAAAGCAAAAGGAGAATGG - Intergenic
1092775636 12:11942949-11942971 ATGAGAAAGCAGTAGGAGCAAGG + Intergenic
1095395025 12:41752726-41752748 TTGACAAACCTTTAGCTGGATGG - Intergenic
1095663879 12:44771666-44771688 TAAACAAAGCATTGGGAGGAGGG - Intronic
1095788559 12:46138237-46138259 TTGAAAAATCATTTGTAGGAAGG + Intergenic
1096406226 12:51346219-51346241 TTGCCAAAGCATTAGGGGGCTGG - Intronic
1097151123 12:56980729-56980751 CAGAGAAAGCATTAGGAGAAAGG - Intergenic
1097365052 12:58702558-58702580 TTGAAAAAACATTAGGTGAATGG + Intronic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1097701800 12:62827931-62827953 TCGACTCAGCATTAGGAGGATGG + Intronic
1100512809 12:95293868-95293890 TTGACAAAGTATTAGTACCAAGG + Intronic
1100917517 12:99442424-99442446 TTGACACATCTTTAGGAGTATGG - Intronic
1102787320 12:115615111-115615133 TGGAGAAAGCATCAGGAAGAGGG - Intergenic
1103136954 12:118515811-118515833 TTGACCAAGCATAAGCAAGAAGG - Intergenic
1104814923 12:131640134-131640156 TTGACAGAGGACTGGGAGGATGG - Intergenic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1108257755 13:48627222-48627244 TTCACAAACCATTGGGAGGATGG + Intergenic
1108346489 13:49551602-49551624 TTAAAAAAGCATTAGAAGGCCGG + Intronic
1108791128 13:53970439-53970461 ATGACAAAGCGGTAGAAGGATGG + Intergenic
1110563661 13:76936366-76936388 TTGACAAAGCATCCTGAAGAAGG - Intergenic
1110945810 13:81414486-81414508 TTGCCAAGGTCTTAGGAGGAGGG + Intergenic
1111666983 13:91281918-91281940 TTGACAGAGGATAAGGTGGAAGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1113362366 13:109643282-109643304 TTGACCAAGCATCAGGATGGGGG - Intergenic
1113664108 13:112128871-112128893 GTGACAAAGCAATGGGAGAAAGG - Intergenic
1114739885 14:25084952-25084974 TTTACTAAGCCTTAGGAGTAGGG + Intergenic
1116966593 14:51021616-51021638 TTGATATGGCATTAGGATGAAGG - Intronic
1119747219 14:77052929-77052951 GTGACAAACCATGAGGAGGCAGG + Intergenic
1124818105 15:33017155-33017177 TTGCCAAGGCCTTGGGAGGAGGG + Intronic
1125874861 15:43134585-43134607 TTGTCAAAGCAGTAGAAGCAAGG + Intronic
1126994566 15:54425975-54425997 CTGACAAAGAATTTGGAAGATGG - Intronic
1128753263 15:70163859-70163881 TGGACCAAGAATTAGGAGGCTGG + Intergenic
1129318606 15:74761459-74761481 TTGACAAAGGAATCTGAGGAGGG + Intergenic
1130266915 15:82414259-82414281 CTGACAAAGTATTAGGATTATGG + Intergenic
1130505116 15:84532612-84532634 CTGACAAAGTATTAGGATTATGG - Intergenic
1130572407 15:85058800-85058822 TTGACAAACCTTTAGCAAGATGG - Intronic
1131532207 15:93203323-93203345 TTGACAAAGGGGTAGGAGCAGGG - Intergenic
1131699401 15:94917982-94918004 TAGACAAACCAATAGTAGGAAGG - Intergenic
1133427790 16:5707808-5707830 TTGACAAAGATTTATTAGGAAGG + Intergenic
1135620516 16:23951397-23951419 TTGACAAAGTAATACGAAGAGGG - Intronic
1135972606 16:27083558-27083580 TTGCCAAAGCACAAGGAGAAGGG + Intergenic
1137333765 16:47527858-47527880 AGGACAAAGCAGCAGGAGGATGG + Intronic
1137908497 16:52351220-52351242 CTAACAAAGCATTCAGAGGAGGG - Intergenic
1138144385 16:54595645-54595667 CTGACTAAGCATTAAGGGGAGGG - Intergenic
1140802085 16:78497904-78497926 TTAACAAAGCATCAGGGGGCTGG + Intronic
1140973571 16:80037529-80037551 TTGATCAAGAATTAGGAGAAGGG + Intergenic
1143954557 17:10658266-10658288 TTGACAAATCTTTGGGAGGATGG + Intergenic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1145911411 17:28545537-28545559 TTGGCAGAGCCTTAGGAGCAGGG - Intronic
1146233052 17:31130808-31130830 TGGGCAAAGCATTTGGAGGGTGG + Intronic
1147552530 17:41454229-41454251 TTGCCAAAGCTTGAGGAGCAGGG + Intergenic
1150461640 17:65358695-65358717 ATGAAACAGCACTAGGAGGATGG + Intergenic
1153187859 18:2504947-2504969 TTGACAAAACAAAAGGAGAATGG + Intergenic
1156468489 18:37362704-37362726 TTGACACAGGATGGGGAGGAAGG - Intronic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157112111 18:44830945-44830967 TCCACAAAGCATTGGGAGGATGG + Intronic
1158300071 18:56042084-56042106 TTGTCACAGTATTAAGAGGAAGG + Intergenic
1158666360 18:59436359-59436381 TTGATAAAGCGTTAGGAGGGAGG - Intronic
1158680925 18:59565937-59565959 TTGGCAATGCATTTGGGGGATGG - Intronic
1159716310 18:71827633-71827655 TTGTCAAAGCATTGGCTGGATGG - Intergenic
1163336520 19:16675903-16675925 TTGTGATAGCATTAGGAGGTCGG - Intronic
1165263003 19:34636851-34636873 CTGACAAAGCTATGGGAGGAGGG - Intronic
1165536215 19:36448020-36448042 CTCACAAAGCATTATGAGGTAGG + Exonic
925613162 2:5720328-5720350 GAGACAAAGCATTAGGGGGTTGG + Intergenic
926612517 2:14960852-14960874 TTGGCAATGGATTAGAAGGAAGG - Intergenic
928276140 2:29901869-29901891 TTTACAAAGAATTAGGGGTAGGG + Intronic
928392186 2:30918594-30918616 TTGACAAAGCACAGGAAGGAAGG + Intronic
930338508 2:50081833-50081855 TTGAGAAAGTATTACGAGAAAGG + Intronic
930554736 2:52881613-52881635 ATGACATAGAATAAGGAGGAAGG + Intergenic
932378266 2:71257837-71257859 TTGACAAAGAATTTGGAAGAGGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
935634219 2:105237529-105237551 TTGACCAGGCCTTAGGAGGACGG + Intergenic
937570402 2:123351226-123351248 ATGAGACAGCACTAGGAGGATGG - Intergenic
937756877 2:125550303-125550325 ATGAGAAAGCACTAGGGGGATGG + Intergenic
937787114 2:125914086-125914108 TTGGCAAAGCTTTAGGTGGATGG - Intergenic
938389192 2:130891824-130891846 TTGACACAGGAGTTGGAGGAGGG + Intronic
939719294 2:145627916-145627938 TTGAGAAGGCATTTTGAGGAGGG - Intergenic
939895272 2:147784089-147784111 TTTTGAAAGCATTAGAAGGATGG + Intergenic
940543667 2:155055028-155055050 TTGACAAAGAAAAAGGAAGATGG + Intergenic
941036549 2:160575138-160575160 TTGACAAATAATAAGGAAGAGGG - Intergenic
942476258 2:176325784-176325806 TTTATAAAGCAGTAGAAGGAAGG + Intronic
945044546 2:205770525-205770547 TGGACAAAGCCTTGGGAGGCAGG - Intronic
947291403 2:228578877-228578899 CTGATAAAGAATTAGGATGACGG - Intergenic
947838483 2:233191740-233191762 TGAACAAAGCATGAGGAGGGAGG + Intronic
1169182813 20:3584989-3585011 TGTACCAACCATTAGGAGGAAGG - Intronic
1169802569 20:9525748-9525770 TTAACAAAGCTTCAGGAGGAAGG - Intronic
1172362939 20:34326895-34326917 TGGACAAAGCAGTTGGAGGTTGG + Intergenic
1174507986 20:51029192-51029214 TTGATAAAGGCTTAGGATGAGGG - Intergenic
1175133704 20:56807813-56807835 TTGGCAAATGAGTAGGAGGAAGG - Intergenic
1178512137 21:33214420-33214442 ATGCCAAAGCTTTAGGGGGAGGG - Intergenic
1181675548 22:24449226-24449248 AAGACAGAGGATTAGGAGGAGGG + Intergenic
1182742087 22:32575248-32575270 TTGAGGAAGCATTGGGTGGAAGG + Intronic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
1184302598 22:43570993-43571015 TTAACAAAGCAGTATGAGGAAGG + Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
951081418 3:18454501-18454523 TTGAGACAGCACTAGGGGGATGG + Intergenic
951503624 3:23417662-23417684 GGGACAGAGCACTAGGAGGAAGG - Intronic
951865836 3:27306264-27306286 ATGACAAAGGATTACAAGGATGG - Intronic
953522929 3:43659864-43659886 GGGACAAAGCTTTAAGAGGAAGG + Intronic
955545201 3:60020738-60020760 TTCACAAAACAATAGCAGGATGG + Intronic
955719836 3:61869019-61869041 TTCATAAAGCATTAGGAGGACGG + Intronic
956255505 3:67279058-67279080 TTGAGACAACACTAGGAGGATGG - Intergenic
957174351 3:76786536-76786558 ATGAGACAGCATTAGGGGGATGG + Intronic
958162954 3:89840254-89840276 GTTACAAAGCATAAGGTGGAAGG + Intergenic
958421629 3:93937941-93937963 TTAACACAGCTTTAGCAGGAGGG + Intronic
959987483 3:112591310-112591332 TTGACAAACCTTTAGGTAGATGG - Intergenic
961834907 3:129649602-129649624 TTGCCAAAGCAAAAGGAGGCTGG + Exonic
961989639 3:131174217-131174239 TTGACAAATCATTAGAATGGTGG + Intronic
962507272 3:136060475-136060497 ATGAGACAGCACTAGGAGGATGG - Intronic
964179084 3:153862377-153862399 TTGACCAAACATTAACAGGAGGG + Intergenic
965606545 3:170503157-170503179 TTTACAAAGCAAGGGGAGGAGGG - Intronic
965861233 3:173153391-173153413 TGGGCAAAGAATTAGAAGGAAGG - Intergenic
970341365 4:15110667-15110689 TTGCCAAAGTATTAGCATGATGG + Intergenic
973869737 4:55154195-55154217 TTGAAAAAGGATTAGGGAGAGGG - Intergenic
973940426 4:55904088-55904110 TTCTCACAGCATTATGAGGAAGG + Intronic
975409489 4:74032788-74032810 TGCACAAAGTATTAGGAGTAAGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
977954614 4:103012240-103012262 TTCACAAAGCATTAGGACACAGG + Intronic
979768864 4:124497391-124497413 TTAACCAAGCATTAGAGGGAAGG + Intergenic
979799887 4:124895160-124895182 TTGACACAGTATCAGGAGAAGGG - Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
985040099 4:185881804-185881826 TAACCAAAGCATTAGGAGGTAGG + Intronic
986698327 5:10377668-10377690 TTGACAAAACATTAATAGTACGG - Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987456897 5:18158294-18158316 TAAGCCAAGCATTAGGAGGAAGG + Intergenic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
988103615 5:26713624-26713646 TTGATAAAGCACTATGATGAAGG - Intergenic
988216765 5:28285041-28285063 CTGACAAAGCATTAAGAAAAAGG + Intergenic
989519543 5:42384376-42384398 TAGAGAAAGCCTTAGGAGGCTGG + Intergenic
990826469 5:59905061-59905083 TTGACATAGTATTTGGAGGAAGG + Intronic
991086032 5:62649043-62649065 TTGACAAAGCCTAGTGAGGAAGG + Intergenic
991958332 5:72017645-72017667 TTGTGAAAACATTAGCAGGATGG + Intergenic
993520276 5:88891066-88891088 TTAACAAAGAATGAGGAGCATGG + Intronic
995324007 5:110871658-110871680 ATGACAGAGCTTTAGGAGGCTGG - Intergenic
995488310 5:112661965-112661987 TTGCCAAAACATAAGGAGAAAGG + Intergenic
995872679 5:116759300-116759322 TTGACAAAGTACTAGGAGAATGG - Intergenic
995961835 5:117851023-117851045 TTGACAAAGTATGAAGAAGAGGG + Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997897072 5:137728523-137728545 ATGACACAGAATCAGGAGGATGG + Intronic
998845435 5:146304533-146304555 TTTACAAAGCAAAGGGAGGAAGG - Intronic
999528304 5:152433017-152433039 TACACAAAGTGTTAGGAGGATGG + Intronic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000632674 5:163608427-163608449 TTGACAACCCATTTGGGGGAAGG + Intergenic
1003290967 6:4777190-4777212 TTGATAAAGCATTTGGGAGAGGG + Intronic
1003559438 6:7168777-7168799 TTGAAAAACCATTTGGAGAAGGG - Intronic
1007220580 6:40275742-40275764 TTTAGATAGCCTTAGGAGGAGGG - Intergenic
1007883644 6:45198428-45198450 ATAACAAAGTATTAGGAGGAAGG - Intronic
1010324909 6:74553325-74553347 TTGAGAAAGCATGAGCAGGTGGG - Intergenic
1010364366 6:75032093-75032115 TTGAAAAAGGATTAGAAGAATGG + Intergenic
1012129502 6:95472674-95472696 TTGAAAAAACATTAGAAGAATGG + Intergenic
1012664116 6:101944053-101944075 ATGAGACAGCATTGGGAGGACGG - Intronic
1012817392 6:104041345-104041367 ATGAGATAGCAGTAGGAGGATGG + Intergenic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1014053877 6:116990165-116990187 ATGAGATAGCATTAGGAGGTAGG + Intergenic
1015422582 6:133027619-133027641 TTGACAAACCAGTAGGACCAGGG - Intergenic
1016814027 6:148287136-148287158 TTGCCCAAGCATCTGGAGGAAGG - Intronic
1018552181 6:165010238-165010260 GAGACAAAGTATCAGGAGGAAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020702644 7:11502243-11502265 TTCCAAAAGGATTAGGAGGAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024227718 7:47339626-47339648 TTGAGAAAGAATTAAGTGGAAGG - Intronic
1024421978 7:49178850-49178872 TTGAGAAAGCAATAGGAACAGGG - Intergenic
1025582810 7:62741672-62741694 TTGAAAAAACATTAGAAGAATGG - Intergenic
1025869338 7:65416021-65416043 TTGAAAAAGGATTAGATGGATGG + Intergenic
1026410647 7:70118447-70118469 TTGACAAATCATTAGGTAGGAGG + Intronic
1028521640 7:91738194-91738216 CTGACAAAGATTGAGGAGGAGGG - Intronic
1030140945 7:106303845-106303867 GGGACGAAGCTTTAGGAGGAAGG - Intergenic
1031424170 7:121585597-121585619 TTGACAAAGAAAAAGGAAGATGG - Intergenic
1032672629 7:134099292-134099314 GGGACAAAGCATGAGGCGGATGG - Intergenic
1033592018 7:142816967-142816989 TTGTCAAAGCATTGTGGGGAAGG - Intergenic
1035662388 8:1358005-1358027 TTGACAAACCAAATGGAGGAAGG + Intergenic
1037143647 8:15547651-15547673 GTGAGAAAGTATTAGGAGGTGGG + Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1038873238 8:31519493-31519515 TGGACAAAGCATCCAGAGGAAGG - Intergenic
1041134780 8:54746258-54746280 TTGACATAGCATTTTGAGCAGGG + Intergenic
1043033215 8:75165053-75165075 TTGACCAAGAACTGGGAGGATGG - Intergenic
1043335360 8:79169799-79169821 TTGACAGACTAGTAGGAGGATGG - Intergenic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1046045641 8:108961022-108961044 TTGACAAAGAAAGGGGAGGATGG + Intergenic
1049126950 8:140799239-140799261 TTTACAAAGCAGTTTGAGGAAGG - Intronic
1051100339 9:13513886-13513908 GTGACAAAGCACTAACAGGAAGG - Intergenic
1052443644 9:28531220-28531242 TTGATAAAGCATTACTATGAGGG - Intronic
1055014852 9:71605243-71605265 TTGACAAATCATTTTGAGGTGGG + Intergenic
1056539152 9:87556565-87556587 TTGGCAGAGCATGGGGAGGATGG + Intronic
1060126467 9:121052596-121052618 TTGAGGCAGCATTAGCAGGAAGG - Intergenic
1061567642 9:131454034-131454056 TTGCCACAGGATTAGGAGGTGGG - Intronic
1062178196 9:135175978-135176000 ATGACAAACCATTAGAAAGAAGG - Intergenic
1186145001 X:6615879-6615901 ATGAGACAGCACTAGGAGGATGG - Intergenic
1186169454 X:6861416-6861438 TTTAGAAAGCATTAGGGGAAAGG - Intergenic
1186327330 X:8494034-8494056 CTGACAAAGCATCAGAAGGAGGG - Intergenic
1186810425 X:13182390-13182412 GGGACAAAGCATTTAGAGGAAGG + Intergenic
1187088400 X:16066572-16066594 CTGACACAGGATAAGGAGGAAGG - Intergenic
1188157982 X:26764908-26764930 TTTACAAAGTATTAGGAAGCAGG - Intergenic
1188255981 X:27962212-27962234 TTCACAAATAATTAGGAGGCTGG + Intergenic
1188337839 X:28960278-28960300 TTCAAAAAGCATTAGGAAAAGGG + Intronic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1193206442 X:78753802-78753824 TTAACACAGCATTAGAAGCAAGG - Intronic
1194069765 X:89307264-89307286 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1194150687 X:90322625-90322647 ATGAGACAGCACTAGGAGGATGG + Intergenic
1194564361 X:95465607-95465629 TTGAAAAAGTTTTAGAAGGATGG - Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1198999773 X:142621353-142621375 TTAACAAGGTATTATGAGGAAGG - Intergenic
1199458290 X:148054077-148054099 TGGCCAAAGCAGTAGGAAGATGG + Intergenic
1200497054 Y:3899386-3899408 ATGAGACAGCACTAGGAGGATGG + Intergenic
1200723912 Y:6641400-6641422 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1200943430 Y:8808196-8808218 TTGCCAAAGCAGTAGCACGATGG + Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1201434675 Y:13944044-13944066 CTGACAAAGCATCAGAAGGAAGG + Intergenic
1201559788 Y:15303708-15303730 TTTAGAAAGCATTAGGGGAAAGG - Intergenic
1201954884 Y:19612967-19612989 TTGAAAAAGCATTTTCAGGAGGG + Intergenic