ID: 1013566996

View in Genome Browser
Species Human (GRCh38)
Location 6:111375500-111375522
Sequence CTACCTCATCCCATGGAAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013566996 Original CRISPR CTACCTCATCCCATGGAAAT TGG (reversed) Exonic
900828875 1:4949650-4949672 GTGTCTCTTCCCATGGAAATGGG - Intergenic
901220086 1:7578743-7578765 CTTCATCATCCCATGGAAGGAGG + Intronic
902837867 1:19058379-19058401 CTACCTCTTCCCAAGGCAGTGGG - Intergenic
904057129 1:27678636-27678658 CTACCTTATCCTATTCAAATTGG + Intergenic
907085401 1:51668069-51668091 ATACCTAATCCCATGAAAAAAGG - Intronic
907979674 1:59469354-59469376 CTGCATCATCCCATGGCAAAGGG + Intronic
910050969 1:82973577-82973599 CTACCTTATCCCAAGGACAGAGG - Intergenic
910764574 1:90768583-90768605 CTACTACATCCCAGGAAAATTGG - Intergenic
910769581 1:90817426-90817448 CTACCTCACCCCTTGGATCTCGG + Intergenic
911220597 1:95241350-95241372 CTACATCACCCCATTGAACTTGG - Intronic
911550561 1:99274457-99274479 CTACCTGATTCCCTGGAAAGGGG + Intronic
911672276 1:100620505-100620527 CTACATCATCCCATGGCAGAAGG - Intergenic
912806181 1:112758765-112758787 CTCCCTCTCCCCATGGACATAGG + Intergenic
913361799 1:117989323-117989345 CTACTTCCACTCATGGAAATGGG + Intronic
915520288 1:156437832-156437854 TTACCACAACCCAGGGAAATTGG - Intergenic
920812950 1:209304215-209304237 CTACCTTCTCCAATGGAACTGGG - Intergenic
921745383 1:218734566-218734588 CTACCTCATCTCATCGAAAAGGG - Intergenic
921893289 1:220373753-220373775 CTACATCATCCCATGGTGAAAGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1066629739 10:37447380-37447402 CTACATCATCTCATGGAAGAAGG - Intergenic
1069101741 10:64330830-64330852 CTGATTCTTCCCATGGAAATGGG - Intergenic
1072945502 10:99806425-99806447 CTACTTCAAACCATTGAAATTGG + Intronic
1074221176 10:111439601-111439623 TTGCCTGAACCCATGGAAATAGG + Intergenic
1077997063 11:7463172-7463194 CTGCTTCTGCCCATGGAAATGGG + Intronic
1078943037 11:16030888-16030910 CTACCTCATTCCAATGAAACAGG + Intronic
1080167112 11:29251957-29251979 GCACATCATCACATGGAAATAGG - Intergenic
1085728422 11:78975345-78975367 CTCCCACATCCCATGGAAACTGG - Intronic
1090947431 11:131443791-131443813 ACACCTCATGCCATGGAAGTTGG - Intronic
1096452938 12:51759892-51759914 CTACATCATCCCATGGTAGAAGG + Intronic
1098651774 12:72979594-72979616 CTACATCATCCCATGGCAGAAGG - Intergenic
1107235640 13:38166583-38166605 CTACCACATGCCAGGGAGATGGG + Intergenic
1108065003 13:46568334-46568356 CTACCACATCCCATGTGCATGGG - Intronic
1109383123 13:61591188-61591210 CTGCATCATCCCATGGCAAAAGG - Intergenic
1109784567 13:67156686-67156708 CTACCTCATCTCAAGGACAGAGG - Intronic
1110785531 13:79520471-79520493 CTACCACATCCCTTGGATAAGGG - Intronic
1112446068 13:99465463-99465485 CTACCTCAGCCCAGAGCAATGGG - Intergenic
1112760197 13:102686716-102686738 CAACTTCGTCCCATGGAAACTGG + Intronic
1113834352 13:113319039-113319061 CCACCTCACCCCATGGGAAATGG - Intronic
1116625316 14:47255609-47255631 AAACTTCATCCTATGGAAATTGG - Intronic
1117391672 14:55268464-55268486 CTACATCATCCCATGGTATAAGG + Intergenic
1120178705 14:81321863-81321885 CCATCCCATCCCATGGAAACTGG + Intronic
1120962859 14:90141033-90141055 CCACCCCATCCCCTGGAAATGGG + Intronic
1121819310 14:96953521-96953543 CTTCCTCATGCCATTGAAAATGG + Intergenic
1122248580 14:100422300-100422322 CTTCCTCATCCCATGGCAGCTGG + Intronic
1129747140 15:78030595-78030617 CCACCTCACCCAATCGAAATGGG + Intronic
1131140221 15:89971315-89971337 CCACCTGATACCATGGACATGGG + Intergenic
1131364501 15:91827049-91827071 CTACCTCCTTCCAGGGAAGTGGG + Intergenic
1131601363 15:93852338-93852360 CTTCCTCATCAATTGGAAATGGG + Intergenic
1135329411 16:21548546-21548568 TAACCTCATCCAATAGAAATGGG + Intergenic
1136339745 16:29634501-29634523 TAACCTCATCCAATAGAAATGGG + Intergenic
1136625046 16:31457178-31457200 CTACCTCTTCCCAGAGGAATGGG - Intergenic
1137826749 16:51504228-51504250 CTTCCTCATCCCATCGATATGGG - Intergenic
1138212970 16:55178682-55178704 CTACCTCCTCCTATGCACATGGG + Intergenic
1138803903 16:60070382-60070404 TTCCCTCATCCAATGGAACTAGG + Intergenic
1140904700 16:79400380-79400402 CTTCTTCATCCCATGGAATAAGG + Intergenic
1142042419 16:87903062-87903084 TAACCTCATCCAATAGAAATGGG + Intronic
1142943196 17:3400623-3400645 CTACATCATGTCATTGAAATTGG + Intergenic
1143130430 17:4673935-4673957 CCACCCCATCCCATGGGAAGGGG - Intronic
1144119740 17:12140289-12140311 CTCATTCATCCCATGGAACTTGG + Intronic
1145972324 17:28963668-28963690 TTACTTCTTCCCCTGGAAATTGG + Intronic
1147351348 17:39848090-39848112 TTACCTTAGCCCAAGGAAATAGG - Intronic
1148027456 17:44598550-44598572 CTTCCTCAGGCCTTGGAAATAGG + Intergenic
1149440565 17:56670334-56670356 CTTCCTCACACCATGGAGATTGG + Intergenic
1156215098 18:34989929-34989951 CTAACTCACCCCATTGAGATGGG - Intronic
1159341497 18:67140096-67140118 TTTCCTCATCCCATTGACATTGG + Intergenic
1164140621 19:22458500-22458522 CTACCTCATATCATGAAGATGGG + Intronic
1167531651 19:50021441-50021463 CTGCCTCATGCCGTGGAAACTGG - Intronic
1168469382 19:56628201-56628223 CTAGCTCATCTCATGTAATTTGG - Intergenic
927396110 2:22653974-22653996 CCATCTCCTCCCATGCAAATAGG + Intergenic
928792415 2:34973660-34973682 TTACCAGAACCCATGGAAATGGG + Intergenic
933009233 2:77036949-77036971 CTACTTAATTCCATAGAAATTGG + Intronic
933212529 2:79587327-79587349 CTTCCTCATCTCATTAAAATGGG - Intronic
933222964 2:79712535-79712557 CTGCCTCATCCCAAGGATTTGGG - Intronic
933715413 2:85356096-85356118 ATACCTCATCACAGGGGAATTGG - Intronic
939076693 2:137610693-137610715 ATATCTCTTCCCATAGAAATGGG - Intronic
939793438 2:146610304-146610326 CTACCTTATCTCATGTATATGGG - Intergenic
940041185 2:149362657-149362679 CTACATCATCCCATGGCAGAAGG + Intronic
941698225 2:168576080-168576102 CTCCATCATCCCAGTGAAATAGG + Intronic
941698415 2:168577743-168577765 CTCCATCATCCCAGTGAAATAGG + Intronic
941860362 2:170272801-170272823 CTACATCGTCCCATGGCAAAGGG - Intronic
942847358 2:180442738-180442760 CTACCTCACAACATGGCAATTGG - Intergenic
944351639 2:198734408-198734430 CTTCCTCAACCAATGGAAAATGG - Intergenic
948347107 2:237307903-237307925 CAACAACATCCCATGCAAATGGG - Intergenic
948376932 2:237526954-237526976 CTAACTCATCCCATTGTCATAGG + Intronic
948598523 2:239095644-239095666 AGGCCTCCTCCCATGGAAATCGG + Intronic
1174921586 20:54708644-54708666 CTACATCATCCCATGGCAGTAGG + Intergenic
1177470073 21:21548943-21548965 CTACTTCAGCCCATTTAAATAGG - Intergenic
1177745079 21:25202588-25202610 CTGCCTCATCCCATGGCAGAAGG + Intergenic
1178494172 21:33072713-33072735 CAACTTCATCCCCTGGAAAATGG + Intergenic
1182017981 22:27056646-27056668 CTCCCTCATCCCACAGACATAGG - Intergenic
1182295359 22:29308889-29308911 ATACCTGACCCCAAGGAAATGGG + Intronic
1184655864 22:45941820-45941842 AGGCCTCATCCCATGGTAATGGG - Intronic
950096424 3:10333360-10333382 CTTCCTCATCCCATCAAATTGGG + Intronic
953013562 3:39051857-39051879 CTACCTCATCACATGGCTACCGG + Intergenic
953249814 3:41234579-41234601 CTACCTCTTCCTAAGGAAGTGGG - Intronic
953260623 3:41335642-41335664 CTAACCTATCCCATGGAAATTGG + Intronic
955455053 3:59111076-59111098 CTGCGTCATCCCATGGAAGAAGG - Intergenic
955547725 3:60049075-60049097 CTACCTCACCCTATAGACATAGG + Intronic
955785410 3:62532867-62532889 TTACCTGTTCCCATGGACATGGG + Exonic
956873710 3:73442152-73442174 CTGCCTCAACCCTTGGATATGGG + Intronic
957180415 3:76870492-76870514 CTCACACATCTCATGGAAATGGG - Intronic
957333038 3:78790865-78790887 CTGCCCCATCCCTTGGAATTAGG - Intronic
959776826 3:110174788-110174810 TTACCTCTTACCATGGATATGGG - Intergenic
960734839 3:120767532-120767554 CTATCGCACCCCATGGAAATTGG + Intronic
967415942 3:189218469-189218491 TTAGCTCATTCCATGGAGATGGG + Intronic
970338350 4:15077851-15077873 TTACCTGATGCCATGGAAATAGG + Intergenic
971912122 4:32808111-32808133 ATACCTCACCCCATGTAAAATGG - Intergenic
974231564 4:59122383-59122405 CTCCCTGATCACACGGAAATGGG + Intergenic
978526806 4:109675844-109675866 CTGCATCATCCCATGGCAAAAGG - Intronic
979422110 4:120517356-120517378 ATATGTCATCACATGGAAATAGG + Intergenic
980826045 4:138074488-138074510 CTCCCTCATCCCATACCAATAGG + Intergenic
985837170 5:2280118-2280140 CTACCTATTCCCCTGGAAAGAGG + Intergenic
986167314 5:5286114-5286136 CTAGTTCATCCCATTTAAATGGG - Intronic
987154610 5:15076622-15076644 CTGCATCATCCCATGGCAATAGG - Intergenic
987472140 5:18345311-18345333 CTACATCATCCCATGGCAGAAGG + Intergenic
987846616 5:23295625-23295647 CTCCCTGTTCCCATAGAAATGGG + Intergenic
987900136 5:24000293-24000315 CTAAGTCATCCCATGGAATAAGG - Intronic
992942644 5:81777569-81777591 CTACCTACCCCCATGGAAAATGG + Intergenic
993701378 5:91123005-91123027 CTTCCTAATGCCATGGAAAAAGG - Intronic
996035716 5:118756582-118756604 CTTACTCATCCCATGGGACTGGG - Intergenic
996282059 5:121741946-121741968 CTTCCTCATGGCATGGAAGTTGG + Intergenic
997757796 5:136416309-136416331 CTGCCCCATACCATAGAAATGGG + Intergenic
1003757450 6:9137617-9137639 CTACATCATCCCATGGTAGGAGG - Intergenic
1005686250 6:28255718-28255740 CTACCTCCTGCAATGGACATAGG + Intergenic
1007720388 6:43881673-43881695 CTACATCATCCCATGGCAAAAGG - Intergenic
1010514772 6:76760058-76760080 CTACCTTATCCCATGGCAAAAGG + Intergenic
1011883116 6:92057265-92057287 CTGCTTCATCCCATGGAAGAAGG + Intergenic
1011957388 6:93039756-93039778 TAACCTCATCCCATGAAAAGAGG + Intergenic
1011980105 6:93364021-93364043 CTACCCCATCCCCTGAAAACTGG - Intronic
1012471209 6:99574510-99574532 CTACATCATCCCATGGCAGAAGG + Intergenic
1013566996 6:111375500-111375522 CTACCTCATCCCATGGAAATTGG - Exonic
1016200705 6:141403754-141403776 CAAGCTCACCCCATGGAAAGAGG + Intergenic
1016465925 6:144325402-144325424 CTACATCATCCCATGGAAAAAGG - Intronic
1018672284 6:166189633-166189655 CTACCTCTTACCAGGGAATTAGG + Intergenic
1020153456 7:5702020-5702042 CTCCCTGATCCCTAGGAAATGGG - Intronic
1022687814 7:32613002-32613024 TTGGCTCATGCCATGGAAATGGG + Intergenic
1024321182 7:48071512-48071534 CCACCTCACCCCATGGCAGTTGG - Intergenic
1029332103 7:99866953-99866975 CTGCTTCATCCCAAAGAAATGGG + Intergenic
1030532608 7:110729484-110729506 CTCCCTCAACACATGGAGATTGG + Intronic
1031090343 7:117347417-117347439 CTCCCTCTTCCCCTGGATATGGG + Intergenic
1031232803 7:119131343-119131365 CTACATCATCCCATGGCAGAAGG + Intergenic
1031567091 7:123313800-123313822 CTCCCTCACCCCATTAAAATGGG - Intergenic
1032162410 7:129520921-129520943 CTTCCTCTTCACAGGGAAATTGG + Intergenic
1036716869 8:11133664-11133686 ATACCTCCTCCTTTGGAAATAGG + Intronic
1036737831 8:11334059-11334081 CTGCCTCATCCCATGGCAAAAGG - Intergenic
1038107833 8:24456074-24456096 CTTACTCATCCCATGTAACTTGG + Intronic
1039669234 8:39578139-39578161 CTACTTTATCCCAATGAAATAGG - Intergenic
1040586788 8:48750896-48750918 CTACATCATCCCATGGCAGAAGG - Intergenic
1041441986 8:57907107-57907129 CTACTTCATCCCAGGGGAAGTGG + Intergenic
1042449513 8:68928273-68928295 CTACCTCCTCACATGGAAGAAGG - Intergenic
1045638970 8:104225693-104225715 CTACATCTACACATGGAAATTGG + Intronic
1046818860 8:118615122-118615144 CTACCACATCCCTGGGACATGGG + Intronic
1049267611 8:141677444-141677466 CTACCTCAGCCCCTGGATGTTGG + Intergenic
1050419102 9:5444474-5444496 CTACCTCATCCTGTGAAAAGGGG + Intergenic
1050503507 9:6323371-6323393 CTGCATCATCCCATGGAAGAAGG + Intergenic
1051744778 9:20285123-20285145 AAACCTCTTCCCAAGGAAATAGG + Intergenic
1051878001 9:21811134-21811156 CTAGCTCATGCCAGGGAGATGGG - Intronic
1052617106 9:30855130-30855152 CTCCCTCGCCCCATGCAAATTGG + Intergenic
1056145240 9:83722540-83722562 CTAGTGCCTCCCATGGAAATGGG + Intergenic
1057517109 9:95731133-95731155 CTTCCTCATGCCATGGATTTGGG - Intergenic
1057962558 9:99470658-99470680 CTGCCCCAACCCATGGAAATCGG - Intergenic
1187040207 X:15586812-15586834 TAACCTCATAGCATGGAAATAGG + Intronic
1187042969 X:15616406-15616428 TTACCACATCCCATAGAAAGAGG - Intergenic
1187822281 X:23300998-23301020 CTACCTAATGCCATGGTGATAGG - Intergenic
1188283032 X:28293898-28293920 ATACTTCATCTCATGGAATTTGG + Intergenic
1194929484 X:99868391-99868413 CCAGCTCACCCCATGCAAATTGG - Intergenic
1196389514 X:115192514-115192536 CTCCCTCTGCCCATGGAAACGGG + Exonic
1201668170 Y:16483162-16483184 CTACCTTTTCCAATGCAAATGGG + Intergenic