ID: 1013568135

View in Genome Browser
Species Human (GRCh38)
Location 6:111390660-111390682
Sequence CCTCAACTACTGCTGAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013568130_1013568135 -10 Left 1013568130 6:111390647-111390669 CCATTCTTCCTGCCCTCAACTAC 0: 1
1: 2
2: 2
3: 33
4: 440
Right 1013568135 6:111390660-111390682 CCTCAACTACTGCTGAGATAGGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013568135 Original CRISPR CCTCAACTACTGCTGAGATA GGG Intronic
901767707 1:11514510-11514532 CCTCACCTCCTGCTCAGGTAGGG + Exonic
903867407 1:26409760-26409782 CCCCATCCACTGCTGAGAGAGGG - Intergenic
905289278 1:36910548-36910570 CCACCACTGCTGCTGAGAGAGGG - Intronic
906382853 1:45343769-45343791 CCTCAACTGCTACTGAGTTTAGG + Exonic
906777501 1:48543201-48543223 CCTCACCTACTCCTGAGTCAGGG - Intronic
911304472 1:96216005-96216027 CACCAACTGCTGCTGATATAGGG - Intergenic
915441307 1:155947150-155947172 CCTCAACTTCTTCAGAGATGTGG + Exonic
916600574 1:166289522-166289544 CCTCCACTTCTCCTGAGATCAGG - Intergenic
917763802 1:178196015-178196037 CCTCAAATATTTATGAGATATGG - Intronic
920851653 1:209632136-209632158 TCTCAGCTAGTGGTGAGATATGG - Intronic
921551568 1:216542435-216542457 CATCCACTGCTGCTGAGATGTGG - Intronic
921983824 1:221286694-221286716 GCTCAACTTCTGCAGAGCTAAGG + Intergenic
922095746 1:222441533-222441555 ACTCAACCACAGCTGAGAAAAGG + Intergenic
1065129714 10:22608396-22608418 TCTCAGCTACTGCTGAGGAAAGG + Intronic
1065341431 10:24710419-24710441 CCTCACCTACTGTAGAGATCAGG - Intronic
1072789688 10:98309226-98309248 CCTCACCTCCTGCTTAGACACGG - Intergenic
1074188743 10:111117709-111117731 CCACTGCTACTGCTGAGACATGG + Intergenic
1080075977 11:28150078-28150100 CCTAAACTCCTGCTCAGATTAGG + Intronic
1081263297 11:40987583-40987605 GGTCATCTACTGCTGAGAGAAGG + Intronic
1087757778 11:102073384-102073406 CCTCCACCACTGCTGACATCTGG - Intronic
1088351905 11:108899184-108899206 CCAGAACTACTGCAGAGAAAAGG - Intronic
1088482068 11:110303724-110303746 TCTCACCTCCTGCTGAGATGAGG - Intergenic
1089113870 11:116078403-116078425 CCCCAAGTCCTGCTGAGAAATGG + Intergenic
1089860929 11:121589495-121589517 CAGCAACTGCTGCTGAGTTACGG - Intronic
1091642010 12:2244491-2244513 CCTGAACTACTGCTGGGACCTGG - Intronic
1093859043 12:24140994-24141016 CCTCAAATACTTCTAAGAAAAGG + Intergenic
1095330327 12:40953413-40953435 CCTCAACTTCTCTTGAGGTATGG + Intronic
1098541535 12:71663359-71663381 CCTCAGCTGCTGCTGAGAAGAGG + Exonic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102445659 12:113000397-113000419 CTTCAACAACTGCAGAGACAGGG - Intronic
1103318080 12:120073193-120073215 CACCAACTACTGCTGTGATGAGG + Intronic
1105330262 13:19409500-19409522 AGTCAACTACTGCTGAGGCATGG - Intergenic
1105861543 13:24419555-24419577 AGTCAACTACTGCTGAGGCACGG + Intergenic
1105918347 13:24938324-24938346 AGTCAACTACTGCTGAGGCATGG - Intergenic
1106807712 13:33327946-33327968 CTTCAAGTGTTGCTGAGATAAGG + Intronic
1108036730 13:46297964-46297986 CCAAAACTTCTGCTGAGACATGG - Intergenic
1118788760 14:69069326-69069348 CCTGAACTACTGATGAGTCAAGG + Intronic
1119637936 14:76291949-76291971 CCTCAACTAAGGCAGAGATGGGG - Intergenic
1120764581 14:88316866-88316888 CTTCAACCACAACTGAGATATGG - Intronic
1121237491 14:92403191-92403213 CCTCACTTACTGCTGAGAAGAGG - Intronic
1121976900 14:98413147-98413169 CCTCCAAGACTACTGAGATAGGG + Intergenic
1124889813 15:33722471-33722493 CCTCATCTACTCTTGAGATTAGG - Intronic
1131271315 15:90949235-90949257 CCTCAATTACTGCTGTGAGAAGG + Intronic
1133782555 16:8951292-8951314 CTTCAACCTCTGCTCAGATAAGG + Intronic
1136983609 16:35081070-35081092 CCTCTAGTGCTGCTGAGTTAGGG - Intergenic
1140676782 16:77340087-77340109 CAGCAACTACTGCTTAGAGAAGG + Intronic
1142766088 17:2065100-2065122 CCTCCACTACTGCAAAGACAAGG - Exonic
1144686858 17:17231841-17231863 CCTGTCCTCCTGCTGAGATACGG + Exonic
1146712169 17:35051626-35051648 ACACAAATAGTGCTGAGATAAGG + Intronic
1157715065 18:49879229-49879251 CCTCACCTACTGCAGAGCAAAGG + Intronic
1157959158 18:52133199-52133221 CCTCACCTGGGGCTGAGATAGGG - Intergenic
1164073485 19:21791259-21791281 CATCAGCTTCTCCTGAGATAGGG + Intergenic
1166555972 19:43700071-43700093 ACTCACCTGCTGCTGAGATCAGG + Intergenic
928236397 2:29545250-29545272 CCTCAAATACTGCTCAGCCATGG - Intronic
932980891 2:76664819-76664841 CCTCATCTACTACTGAGATGTGG - Intergenic
933043179 2:77496029-77496051 CCACAAATATTGCTGATATAAGG - Intronic
933327644 2:80859111-80859133 CCTAAACTAGTGCTCTGATAAGG - Intergenic
935847671 2:107184387-107184409 CCTCATCTACAGCTGAGAAAAGG - Intergenic
937111362 2:119369015-119369037 CCCCAGCTACTGCGGAAATAGGG - Intronic
939014778 2:136889907-136889929 CCTCTAGTACTGCTAAAATAGGG + Intronic
940774848 2:157875572-157875594 CCTGAACTGCTGGTGGGATATGG - Intronic
940794548 2:158063053-158063075 CCTCTACAACTGCTGAAATCAGG - Intronic
942810737 2:179997443-179997465 CCTAAAATCCAGCTGAGATAAGG - Intronic
943466086 2:188230857-188230879 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
945004164 2:205385703-205385725 CCTCAACTAATGTTGAGTCAGGG - Intronic
946817679 2:223595639-223595661 TCTCAAATACTCTTGAGATAGGG - Intergenic
947965111 2:234273865-234273887 CCTAAACTGCTCCTGAGATCAGG + Intergenic
948108987 2:235439381-235439403 CCTCTACTGCTGCTGAGAAAGGG + Intergenic
948763330 2:240205997-240206019 CCTCCACTACTGAGGAGAAAAGG + Intergenic
1168818275 20:755815-755837 CCTAAACTACTCCTGACATCAGG + Intergenic
1169410263 20:5362884-5362906 CCTCACCTTCTGCTGAAAAAAGG - Intergenic
1179244326 21:39617650-39617672 CTTGAACTACAGCTGTGATATGG - Intronic
1180564628 22:16652327-16652349 AGTCAACTACTGCTGAGGCATGG + Intergenic
952920939 3:38283423-38283445 CTCCAAATTCTGCTGAGATAAGG + Intronic
953886475 3:46717204-46717226 CCTCCCCTCCTGCTGAGGTAGGG - Intronic
955802796 3:62703494-62703516 CCTCAAATATTGCTGACATTTGG + Intronic
956888774 3:73588480-73588502 CCTGAACTACTGCCCAGATCGGG + Intronic
959882553 3:111461472-111461494 ACTAAACTACTGCTGAGGTTGGG - Intronic
962448033 3:135485937-135485959 CCTCAGCAACTGATGAGTTATGG - Intergenic
964529985 3:157657124-157657146 CCTCCACTACCACTGAGGTAGGG + Intronic
967822944 3:193855116-193855138 CCTCAGCTCCTGCTGAGTTTTGG + Intergenic
967940041 3:194758673-194758695 CCTCTAGTACAGCTGAGACAAGG + Intergenic
970538652 4:17055620-17055642 TCTCATCTACACCTGAGATAGGG - Intergenic
970653470 4:18203447-18203469 CCTCAAATACTGCTGAGGCTAGG - Intergenic
974229103 4:59086521-59086543 TTTCAGCTACTGCTGAGACATGG - Intergenic
977528349 4:98171430-98171452 ACTCAACTATTGCTTAGGTATGG + Intergenic
980253254 4:130345651-130345673 CCTCTTCTACTCCTGAGAAAGGG - Intergenic
981322499 4:143409133-143409155 CCTCAACTTCCCCTGAGATAAGG - Intronic
982577577 4:157134736-157134758 CCTCAACTCTTTCTGAAATAGGG - Intronic
984396833 4:179212330-179212352 GCACACCTACTGCTCAGATATGG - Intergenic
986991453 5:13557573-13557595 TCTCAACTGCTGGTGAGAAATGG - Intergenic
987592081 5:19942830-19942852 CCTCGACTGCTGCTGAGAGTCGG - Intronic
992208802 5:74456930-74456952 ACTACACTACTGCTGAGGTAGGG + Intergenic
993489520 5:88529583-88529605 CCACAGCTACAGTTGAGATATGG + Intergenic
997476145 5:134143647-134143669 CCTCCACTGCTGCTGAGAGAAGG - Intronic
1003406442 6:5830473-5830495 CCTCAACTTCAGATGAGATCAGG + Intergenic
1007056262 6:38888235-38888257 GATCAACTACAGATGAGATAAGG + Intronic
1013568135 6:111390660-111390682 CCTCAACTACTGCTGAGATAGGG + Intronic
1022623892 7:32014340-32014362 CAGAAACTACTGCTGTGATAGGG - Intronic
1022784367 7:33623292-33623314 CCTCAATTACTAATGAGATTAGG - Intergenic
1029316648 7:99721642-99721664 CCTCAACACCTGGTGACATATGG + Intronic
1030084267 7:105803544-105803566 CCACCTTTACTGCTGAGATAAGG + Intronic
1031732349 7:125314797-125314819 CCTCAACTGCTGCTGGGAATTGG - Intergenic
1034753402 7:153591870-153591892 CCTCATTTAATGCTTAGATAGGG - Intergenic
1034942938 7:155243701-155243723 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
1037580225 8:20240894-20240916 ACTCCTCTGCTGCTGAGATAAGG - Intergenic
1041488395 8:58404768-58404790 CCTCAACTACTTCTGTAAGATGG + Intergenic
1046344689 8:112907150-112907172 CCATAAGTACTGCTGAGTTAGGG + Intronic
1047822159 8:128532918-128532940 CCCAAACCACTGCTGAAATAGGG - Intergenic
1048499684 8:134964259-134964281 CCTTCCCTACTTCTGAGATAAGG - Intergenic
1056224316 9:84480559-84480581 TCTCAACTTCTGCTGAGTTTTGG + Intergenic
1057551305 9:96052776-96052798 CCTCCACTAGTGCTGAGCTACGG - Intergenic
1057731298 9:97611177-97611199 CCTCCTATAGTGCTGAGATATGG - Intronic
1058979228 9:110153659-110153681 CCACAGCTACTGCTGGGATCTGG + Intronic
1059751876 9:117255282-117255304 CTTGAACTAGGGCTGAGATACGG + Intronic
1193081710 X:77412608-77412630 ACTCAACTACTTTTGAGAAATGG + Intergenic
1194266466 X:91759116-91759138 CCTAAACTACTGCTTAGAAATGG - Intergenic
1197582289 X:128298734-128298756 CCTCAACAACTCCTGAGGAAGGG + Intergenic
1198631228 X:138640872-138640894 CCTCCCATCCTGCTGAGATACGG - Intronic
1200583616 Y:4979685-4979707 CCTAAACTACTTCTTAGAAATGG - Intergenic