ID: 1013570846

View in Genome Browser
Species Human (GRCh38)
Location 6:111424018-111424040
Sequence TACCCAATTGTTGCTCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013570846_1013570848 -10 Left 1013570846 6:111424018-111424040 CCAGTATGAGCAACAATTGGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1013570848 6:111424031-111424053 CAATTGGGTAAGATTTCTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1013570846_1013570850 20 Left 1013570846 6:111424018-111424040 CCAGTATGAGCAACAATTGGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1013570850 6:111424061-111424083 CCAATACCCAATACAAGAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 107
1013570846_1013570854 28 Left 1013570846 6:111424018-111424040 CCAGTATGAGCAACAATTGGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1013570854 6:111424069-111424091 CAATACAAGAGAAGGGACCTAGG No data
1013570846_1013570851 21 Left 1013570846 6:111424018-111424040 CCAGTATGAGCAACAATTGGGTA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1013570851 6:111424062-111424084 CAATACCCAATACAAGAGAAGGG 0: 1
1: 0
2: 1
3: 19
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013570846 Original CRISPR TACCCAATTGTTGCTCATAC TGG (reversed) Intronic
901891197 1:12267009-12267031 TATCCAACTGTTGTACATACTGG - Exonic
903856205 1:26338807-26338829 TTCCCACTTGTTGCTTATGCTGG + Intronic
904764949 1:32838439-32838461 TACCCAATTGTTGGTAAGGCTGG - Intronic
906798185 1:48713968-48713990 TACCCAAGGCTTGCTCATAATGG + Intronic
907799026 1:57746078-57746100 TCCCCAATTGATGAACATACAGG + Intronic
909773293 1:79453370-79453392 TACCAGATTGTAGCTCAGACAGG - Intergenic
918859203 1:189799870-189799892 TACACAACTGTTTCTCAAACTGG - Intergenic
923463496 1:234227870-234227892 TGGCCAATTGATGCTCAAACAGG - Intronic
1063880418 10:10525836-10525858 TACCCAGTGGTGGATCATACTGG + Intergenic
1070651129 10:78237179-78237201 TGCCTAATTGTTTCTCATAATGG - Intergenic
1070840779 10:79486549-79486571 GGCCCAATTGTAGCTCATGCAGG + Intergenic
1083518390 11:63282875-63282897 TAACCCATTGTTGCTACTACTGG - Intronic
1092328438 12:7559821-7559843 TCTTGAATTGTTGCTCATACTGG - Intergenic
1092829898 12:12433649-12433671 TTCCCAATTTCTGCTAATACTGG + Intronic
1093314309 12:17628751-17628773 TATCCAATTGTTGCTTATTAGGG + Intergenic
1096479340 12:51927831-51927853 TACTCAGATGTTGCTCAGACTGG + Intergenic
1096673988 12:53216739-53216761 TACCCAATTGCAGCTCAAAAGGG + Intronic
1098412405 12:70200897-70200919 TACCCAATAGTTGCATTTACAGG - Intergenic
1115179886 14:30611272-30611294 TACCCAATTATTACTCCGACAGG + Intronic
1118245091 14:64102407-64102429 TGCCCATTTGTAGCTCAGACAGG + Intronic
1122003300 14:98682441-98682463 CACCCAATTGTTGGTCTTCCTGG - Intergenic
1127757073 15:62103132-62103154 TTCACACTTGTTGCTCAGACTGG - Intergenic
1132252474 15:100344028-100344050 TGCCCAATTGTTCCTCAGAGTGG - Intergenic
1133474884 16:6111252-6111274 CACCCCATTGTTGGACATACAGG + Intronic
1133976462 16:10602684-10602706 TACCCGATTGATGATCAAACGGG - Intergenic
1144013831 17:11174903-11174925 AACCCAATTCTTGTTCATTCAGG - Intergenic
1153701627 18:7700344-7700366 TACCCAAATCTTGCTCACACTGG - Intronic
1155383032 18:25245584-25245606 TACCCATTTGTTCATCAAACGGG + Intronic
1155738916 18:29261363-29261385 TACCTAATTATTGCCCATATTGG + Intergenic
1156619733 18:38835327-38835349 GACCTAATTGTAGATCATACTGG - Intergenic
1157364988 18:47056388-47056410 TCCCAGATTGTTCCTCATACTGG - Intronic
1160029668 18:75248124-75248146 TACAAAAATGTTTCTCATACTGG + Intronic
1168669564 19:58230234-58230256 TCCCCATCTGTTCCTCATACTGG - Intronic
925947964 2:8883822-8883844 TCCCCAATTGTTGCATATATAGG - Intronic
935719758 2:105969653-105969675 AAATCACTTGTTGCTCATACTGG - Intergenic
940195190 2:151086445-151086467 TTTCCATTTGTTCCTCATACTGG + Intergenic
947277597 2:228411079-228411101 TACCAAATTGTTGGTATTACAGG + Intergenic
1169782872 20:9327982-9328004 TACCCAATTGTTTCTGCTGCTGG + Intronic
1171005804 20:21464677-21464699 TACCGATTTGTTGCAAATACTGG - Intergenic
1174389771 20:50211303-50211325 TATCCAAGTGCTGCTCACACTGG - Intergenic
1175796362 20:61773740-61773762 TATCAAATTGTTGCTCAGATTGG - Intronic
952114520 3:30162818-30162840 AACCCATCTGTTGCTCATAAGGG - Intergenic
954546668 3:51442010-51442032 TATCAAATTGTTGCTATTACAGG - Intronic
956834045 3:73081167-73081189 TACCCAAGTGTTGCGATTACAGG + Intergenic
959729139 3:109581025-109581047 TACCCAATTATTGATCAAAATGG - Intergenic
961846228 3:129766213-129766235 TAAACAATTCTGGCTCATACAGG - Intronic
969828404 4:9776381-9776403 TACCCCACTGTTGCTCTAACAGG + Intronic
975808231 4:78135890-78135912 TACCGAACTGTTGCTCCTAAGGG + Intronic
981670792 4:147284985-147285007 TACCCCATTGGTGCTGATGCAGG - Intergenic
987975986 5:25015639-25015661 TACCTAATTTTTGGTAATACAGG - Intergenic
993334159 5:86635981-86636003 TACTGAATTATTGCTCATAGGGG + Intergenic
995437335 5:112151758-112151780 TTCTCTATTGTTGCTCAAACTGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001353057 5:170991403-170991425 AACCCAATTGTTGCTTGTAAAGG + Intronic
1003017769 6:2481807-2481829 TTCCCAGGTGATGCTCATACTGG + Intergenic
1003796507 6:9611363-9611385 ATCCCAATTTTTGCACATACTGG + Intronic
1004837796 6:19547702-19547724 TGCCCTATTTTTGCTGATACAGG - Intergenic
1005613337 6:27547839-27547861 CACCCAAATATTGCTCATGCTGG + Intergenic
1006554022 6:34850605-34850627 TCACCAATTCTTTCTCATACTGG + Intronic
1010577730 6:77553432-77553454 TACCCAATTTTTCCCCATATGGG - Intergenic
1013570846 6:111424018-111424040 TACCCAATTGTTGCTCATACTGG - Intronic
1014920845 6:127213386-127213408 TTCCCTCTTGTTGCTCAGACTGG + Intergenic
1016681805 6:146839234-146839256 TACCAAATTGTTTTTCAGACTGG - Intergenic
1027377420 7:77566118-77566140 TGCACAATTTTTGCTCTTACTGG - Intronic
1030722755 7:112888593-112888615 TACCCAATTTTTGTTACTACTGG - Intronic
1037039896 8:14218279-14218301 TTTCTAATTGTTGCTAATACAGG - Intronic
1040742219 8:50591525-50591547 TACACAAATGTTGCACATAGGGG - Intronic
1059644903 9:116255423-116255445 TATCCAATGGATGCTCATATTGG - Intronic
1186039412 X:5459852-5459874 TCCCCAAATATTGCCCATACAGG - Intergenic
1187430362 X:19218386-19218408 TACCAAATTGTTTCTCAAACTGG + Intergenic
1195084415 X:101400757-101400779 TACCCATTGTTTTCTCATACAGG - Exonic
1197470388 X:126861184-126861206 TTCCAAATTGTTGTTCATACTGG - Intergenic
1201458324 Y:14195022-14195044 TACCCAATAGTTGCATAAACAGG + Intergenic