ID: 1013572375

View in Genome Browser
Species Human (GRCh38)
Location 6:111441945-111441967
Sequence CGGTCACACCCCCGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013572375_1013572379 12 Left 1013572375 6:111441945-111441967 CCTGTGTCCCGGGGGTGTGACCG 0: 1
1: 0
2: 1
3: 14
4: 108
Right 1013572379 6:111441980-111442002 TTCAGCTTTTCCCCCCACTTAGG 0: 1
1: 0
2: 0
3: 16
4: 374
1013572375_1013572380 21 Left 1013572375 6:111441945-111441967 CCTGTGTCCCGGGGGTGTGACCG 0: 1
1: 0
2: 1
3: 14
4: 108
Right 1013572380 6:111441989-111442011 TCCCCCCACTTAGGTGAAACAGG 0: 1
1: 0
2: 3
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013572375 Original CRISPR CGGTCACACCCCCGGGACAC AGG (reversed) Intronic
900807877 1:4779727-4779749 CGGTGACAGTCCCAGGACACCGG + Intronic
902336549 1:15757978-15758000 CGGCCTGTCCCCCGGGACACCGG + Intronic
910806910 1:91197586-91197608 CAGTCACACCCCAGAGAGACTGG + Intergenic
911130341 1:94381401-94381423 AGGTCACACACCTGGGAGACAGG - Intergenic
914203545 1:145506797-145506819 AGGTCACAGCCCAGGGGCACAGG - Intergenic
914482667 1:148079951-148079973 AGGTCACAGCCCAGGGGCACAGG - Intergenic
916650990 1:166834242-166834264 AGGTCCCAGCCCAGGGACACAGG + Intergenic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
918771872 1:188571476-188571498 AGCTCACAACCCAGGGACACAGG + Intergenic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
1064703878 10:18050254-18050276 AGGTCACAGCCCAAGGACACGGG + Intergenic
1069654699 10:70079244-70079266 GGGTCCCACCCCCGAGACTCTGG + Intronic
1073425936 10:103455501-103455523 GGGTCACACCCACGGGACACTGG - Exonic
1074799710 10:116987230-116987252 AGGTCACATCCTAGGGACACAGG + Intronic
1076099376 10:127763233-127763255 AGATCACAACCCAGGGACACAGG - Intergenic
1077117563 11:892153-892175 GGGCCCCACACCCGGGACACAGG + Intronic
1080543815 11:33296214-33296236 CGGCCATACCACAGGGACACTGG - Intronic
1081772533 11:45658839-45658861 AGGCCCCACCCCCTGGACACCGG + Intronic
1082067876 11:47915548-47915570 GGGTCACCCTCCCAGGACACAGG - Intergenic
1083272722 11:61580411-61580433 CGCTGGCACCCCCGGGGCACCGG + Intronic
1083904856 11:65662835-65662857 CGGCCCCGCCCCCGGGACCCCGG - Exonic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1101910825 12:108858970-108858992 AGGTCACAGCCCCAGGACAGAGG - Intronic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1106784192 13:33090818-33090840 AGGTCACAACCCCGGAACAAGGG - Intergenic
1107980132 13:45727371-45727393 AGGTCACAGCCCAGGGGCACAGG - Intergenic
1110790808 13:79584714-79584736 AGGTCACAGCCCAGGGACACAGG + Intergenic
1111818134 13:93180761-93180783 AGCTCACAGCCCAGGGACACAGG - Intergenic
1113086717 13:106576509-106576531 AGGTCACAGCCCAGGGTCACAGG - Intergenic
1116083826 14:40208679-40208701 AGGTCACAACCCTGGAACACAGG + Intergenic
1119824473 14:77645685-77645707 CGGTAACACTCCCGCGAAACTGG + Intergenic
1121011212 14:90521323-90521345 CTGTCACACGCCAGGGCCACTGG + Intergenic
1122110542 14:99498034-99498056 CAGTCACACCCCCGTCACAGGGG + Intronic
1124171819 15:27381103-27381125 AGGTCACAGCCCAGGAACACAGG - Intronic
1125599239 15:40906564-40906586 CGGCCACACCCCCAGGAGCCAGG - Intergenic
1126356484 15:47801716-47801738 CGGGCAGATCCCTGGGACACAGG + Intergenic
1130055289 15:80518704-80518726 AGGTCACAGCCCCAGGACATAGG - Intronic
1133130055 16:3671434-3671456 CAGTCACAACCCTGGGGCACAGG + Intronic
1134565888 16:15251601-15251623 CGGTCACAGCTCCTGGCCACTGG - Intergenic
1134736606 16:16505097-16505119 CGGTCACAGCTCCTGGCCACTGG + Intergenic
1134930908 16:18207071-18207093 CGGTCACAGCTCCTGGCCACTGG - Intergenic
1137308910 16:47233744-47233766 AGGTCACAGCCCAGGGACACAGG + Intronic
1137869638 16:51937578-51937600 CGGCCACACCCCCGTGAAGCTGG - Intergenic
1138999531 16:62492642-62492664 CGGGTACACCACCAGGACACAGG + Intergenic
1141126452 16:81404201-81404223 CGGTCACAGCGGCGGGACCCCGG - Intergenic
1141152034 16:81570850-81570872 CAGTCACGCACCTGGGACACAGG - Intronic
1141657080 16:85422113-85422135 CGGGCACACCCTGGGGACATGGG - Intergenic
1142113548 16:88344788-88344810 CGGTCTCGCCTCTGGGACACGGG - Intergenic
1142621162 17:1166486-1166508 CTGCCACACCCCCGGGCCTCCGG - Intronic
1144789075 17:17847575-17847597 CGCTCGCACCCCGTGGACACCGG - Exonic
1160037735 18:75317113-75317135 TGGTCTCACCCCTGTGACACAGG + Intergenic
1160688432 19:448386-448408 CGGCCACAAGCCCGGGACGCCGG - Intronic
1161015351 19:1980355-1980377 CGGCCCCACCCCCGGGACGTGGG + Exonic
1161145993 19:2678499-2678521 GGGTCACACCCACTGTACACAGG + Intronic
1161396025 19:4045387-4045409 CGTTCACACCCCAGTGTCACAGG - Exonic
1164951832 19:32343774-32343796 TGGCCACACCCCCGAGCCACAGG + Intergenic
1168145166 19:54416333-54416355 CGGCCCCACCCTCGGGACCCGGG - Intronic
936007614 2:108905235-108905257 AGTTCACACCCCTGGGACAGAGG - Intronic
937228559 2:120383788-120383810 CGGCCACCCCCCAGGGCCACAGG - Intergenic
938076633 2:128342073-128342095 TGGTAACACCCCCTGGACACCGG - Intergenic
942108411 2:172656401-172656423 AGGTCACAGCCCAGGGACACGGG - Intergenic
947860600 2:233354783-233354805 CGGTGACGCCCGCGGGACCCCGG - Intronic
1170163755 20:13342469-13342491 CTGTGACAGCCTCGGGACACAGG + Intergenic
1175686937 20:61038092-61038114 CTGTCACAGCCCTGAGACACAGG - Intergenic
1179156352 21:38854256-38854278 AGGTCACAGCCCAGGGACACAGG + Intergenic
1180845316 22:18978104-18978126 CTGTCAGACCCCCGGCACAGAGG + Intergenic
1181285433 22:21748538-21748560 AGGTCACAGCCCAGGGACACAGG + Intergenic
1183310701 22:37108088-37108110 CCGTCGCACCCCAAGGACACTGG + Intronic
1183949914 22:41347181-41347203 CAGCCAAACCCCCAGGACACAGG + Intronic
1185052860 22:48562899-48562921 CTCTCACAGCCCCGGGACCCCGG + Intronic
1185148590 22:49152028-49152050 CGGGCACACAGCGGGGACACGGG + Intergenic
950461154 3:13122911-13122933 TGGTCACGCTCCCAGGACACAGG + Intergenic
954662309 3:52232593-52232615 AGGTCACAGCCCCAGGCCACAGG + Intronic
955147004 3:56329655-56329677 AGGTCACAGCCCAGGGGCACAGG + Intronic
960749897 3:120936963-120936985 AGGTCACAGCCCAAGGACACAGG - Intronic
968046408 3:195626113-195626135 CGGTGACAGCCCCGGGTCACAGG + Intergenic
968308245 3:197663978-197664000 CGGTGACAGCCCCGGGTCACAGG - Intergenic
968593650 4:1471854-1471876 CCCCCACACCCCCGAGACACCGG - Intergenic
971477808 4:27088820-27088842 AGCTCACAGCCCAGGGACACGGG - Intergenic
976653008 4:87456283-87456305 GGGTCACAGCCCAGGGCCACAGG - Intronic
978218537 4:106239288-106239310 AGGTCACAGCCCAGGAACACAGG + Intronic
978663588 4:111155534-111155556 ATGTCACAACCCAGGGACACAGG - Intergenic
980053816 4:128061612-128061634 CCGTCTCTCCGCCGGGACACCGG - Intronic
980338089 4:131501330-131501352 AGGTCACAGGCCAGGGACACAGG + Intergenic
985912961 5:2897384-2897406 TGGCCCCACCCCAGGGACACAGG - Intergenic
986897443 5:12387237-12387259 AGTTCACACCCCTGAGACACAGG - Intergenic
991606486 5:68406960-68406982 GGGTCACAGCCCCGGGAGAAAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993971817 5:94429410-94429432 CAGTCACACCCCCCAGAAACAGG - Intronic
995321304 5:110837360-110837382 AGGTCACAGCCCAGGGACACAGG - Intergenic
996553147 5:124750785-124750807 AGATGACACCCCAGGGACACAGG - Intergenic
999384538 5:151145041-151145063 CTGTCACACCTCCGGCAGACAGG + Intronic
1002685467 5:181005855-181005877 CTGTCTCATCCCCAGGACACTGG - Exonic
1003250112 6:4420379-4420401 GGGTCACAGCCCAGGGGCACAGG + Intergenic
1005186683 6:23170499-23170521 AGGTCACAGCCCTGAGACACAGG + Intergenic
1007208766 6:40174332-40174354 CGGTCCCACCCCCTTGACCCTGG + Intergenic
1009627839 6:66160028-66160050 AGGTCACAGCCCAGGGATACAGG + Intergenic
1013572375 6:111441945-111441967 CGGTCACACCCCCGGGACACAGG - Intronic
1014256970 6:119170145-119170167 TGGTGACTCCCCCGGTACACAGG - Intergenic
1019837043 7:3398376-3398398 AGGTCACAGCCCAGGGACTCAGG - Intronic
1022961283 7:35429216-35429238 CGGTCACACTCCCCAAACACTGG - Intergenic
1028902425 7:96116376-96116398 CAGACACACCCCCAGCACACTGG - Intergenic
1029626455 7:101722932-101722954 GGGTCAGACCCCCGGGTCCCGGG - Intergenic
1029735007 7:102460766-102460788 CGGGCCAACCCCTGGGACACCGG - Intronic
1030657570 7:112184670-112184692 TGGTCACACGCCTTGGACACTGG + Intronic
1035772075 8:2155638-2155660 CGGTCACACCCCTTGGTCACAGG + Intronic
1041163836 8:55072082-55072104 AGATCATACCCCAGGGACACAGG + Intergenic
1041662048 8:60410410-60410432 CGGTCCCTCCCCCGACACACGGG + Intergenic
1044783147 8:95764040-95764062 CAGTCAGAACCCCAGGACACAGG + Intergenic
1045434406 8:102146799-102146821 AGGCCACAGCCCAGGGACACAGG + Intergenic
1047896899 8:129376268-129376290 AGGTCACAGCCCAGGGATACAGG + Intergenic
1048171376 8:132109870-132109892 CAGTCACACTCCCGGGAGAAGGG + Intronic
1049782637 8:144435872-144435894 CGGCCCCGCCCCCGGGGCACTGG - Exonic
1051981362 9:23023518-23023540 AGGTCACAGCCCAAGGACACAGG - Intergenic
1057353918 9:94320335-94320357 GGGTCTCACCCTGGGGACACAGG - Exonic
1057653832 9:96937255-96937277 GGGTCTCACCCTGGGGACACAGG + Exonic
1060811146 9:126612236-126612258 CGGACACACACCCCAGACACAGG + Intergenic
1061036106 9:128115156-128115178 AGATCACACCACCGGGACCCAGG - Intergenic
1062431125 9:136527339-136527361 TGGCCACACCCCCGGTACCCGGG + Intronic
1194105617 X:89763198-89763220 AGGTCACAGCCCAGGGACACAGG - Intergenic
1196853414 X:119960800-119960822 AGGTCACAGCCCAGGGACACAGG - Intergenic
1196858893 X:120008891-120008913 AGGTCACAGCCCAGGGACACAGG + Intergenic
1200457580 Y:3411023-3411045 AGGTCACAGCCCAGGGACACAGG - Intergenic
1201549386 Y:15203950-15203972 CAGTCACACCCACTGGCCACAGG - Intergenic