ID: 1013572552 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:111444114-111444136 |
| Sequence | ATCTGCCAGTAGATGTTTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3538 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 39, 4: 3497} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1013572552_1013572554 | -10 | Left | 1013572552 | 6:111444114-111444136 | CCTTCAAACATCTACTGGCAGAT | 0: 1 1: 0 2: 1 3: 39 4: 3497 |
||
| Right | 1013572554 | 6:111444127-111444149 | ACTGGCAGATTAGGAAGTATTGG | No data | ||||
| 1013572552_1013572555 | 3 | Left | 1013572552 | 6:111444114-111444136 | CCTTCAAACATCTACTGGCAGAT | 0: 1 1: 0 2: 1 3: 39 4: 3497 |
||
| Right | 1013572555 | 6:111444140-111444162 | GAAGTATTGGTTAAAAACACAGG | 0: 1 1: 0 2: 0 3: 12 4: 219 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1013572552 | Original CRISPR | ATCTGCCAGTAGATGTTTGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||