ID: 1013572552

View in Genome Browser
Species Human (GRCh38)
Location 6:111444114-111444136
Sequence ATCTGCCAGTAGATGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3538
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 3497}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013572552_1013572554 -10 Left 1013572552 6:111444114-111444136 CCTTCAAACATCTACTGGCAGAT 0: 1
1: 0
2: 1
3: 39
4: 3497
Right 1013572554 6:111444127-111444149 ACTGGCAGATTAGGAAGTATTGG No data
1013572552_1013572555 3 Left 1013572552 6:111444114-111444136 CCTTCAAACATCTACTGGCAGAT 0: 1
1: 0
2: 1
3: 39
4: 3497
Right 1013572555 6:111444140-111444162 GAAGTATTGGTTAAAAACACAGG 0: 1
1: 0
2: 0
3: 12
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013572552 Original CRISPR ATCTGCCAGTAGATGTTTGA AGG (reversed) Intronic
Too many off-targets to display for this crispr