ID: 1013572554

View in Genome Browser
Species Human (GRCh38)
Location 6:111444127-111444149
Sequence ACTGGCAGATTAGGAAGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013572552_1013572554 -10 Left 1013572552 6:111444114-111444136 CCTTCAAACATCTACTGGCAGAT 0: 1
1: 0
2: 1
3: 39
4: 3497
Right 1013572554 6:111444127-111444149 ACTGGCAGATTAGGAAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013572554 Original CRISPR ACTGGCAGATTAGGAAGTAT TGG Intronic
No off target data available for this crispr