ID: 1013572555

View in Genome Browser
Species Human (GRCh38)
Location 6:111444140-111444162
Sequence GAAGTATTGGTTAAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013572552_1013572555 3 Left 1013572552 6:111444114-111444136 CCTTCAAACATCTACTGGCAGAT 0: 1
1: 0
2: 1
3: 39
4: 3497
Right 1013572555 6:111444140-111444162 GAAGTATTGGTTAAAAACACAGG 0: 1
1: 0
2: 0
3: 12
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013572555 Original CRISPR GAAGTATTGGTTAAAAACAC AGG Intronic
901584915 1:10281669-10281691 TAAGTCCTGGTTAAAAACTCAGG - Intronic
904644832 1:31957877-31957899 GAAGTAGAGGTTGAAGACACAGG - Intergenic
905152379 1:35940944-35940966 GAAGTGTTATTTAAAACCACTGG - Intronic
905160371 1:36027887-36027909 AATGTAGTGGTTAAAAGCACAGG + Intronic
906365203 1:45204525-45204547 GTTGTTTTGGTTAGAAACACAGG + Intronic
909417350 1:75422048-75422070 GAAATACTTGTTAAAACCACTGG + Intronic
912862067 1:113222617-113222639 GAAATGATGGTGAAAAACACTGG - Intergenic
916777884 1:167988011-167988033 TAATTATTGGTTTAAAAGACAGG - Intronic
916911704 1:169355966-169355988 GAATTATGGGTCAAAAACAGTGG - Intronic
918925377 1:190779064-190779086 GGAGTATTGGTTAATACCACTGG + Intergenic
919308689 1:195878015-195878037 GAGGTATTGGGTAAATACAGTGG + Intergenic
921549781 1:216520956-216520978 GACCTATTGGTGAAAAACAGTGG + Intronic
923120199 1:230983057-230983079 GCAGGATTGGTTAAAAGCAAGGG - Intronic
1063309460 10:4938573-4938595 GAAGTTTGGGTTAGAAAAACAGG + Intronic
1063742364 10:8837918-8837940 GACGTACAGGATAAAAACACAGG + Intergenic
1064970118 10:21057007-21057029 AAAGTATTATTTAAAAAAACAGG + Intronic
1066483863 10:35824890-35824912 GAAATATTGCATAAAAACCCAGG + Intergenic
1066643695 10:37583192-37583214 TAAGTATTCATTTAAAACACAGG - Intergenic
1069259175 10:66372537-66372559 GAAGGATGGGTTAACAACAGTGG - Intronic
1069378338 10:67817356-67817378 GGAGTAGTGGATATAAACACAGG - Intronic
1069580243 10:69560834-69560856 GTAGCAGTGGTTAAAAGCACTGG + Intergenic
1070049768 10:72876835-72876857 GAGGGAGAGGTTAAAAACACAGG - Intronic
1070557975 10:77544782-77544804 AGAATTTTGGTTAAAAACACAGG - Intronic
1072773215 10:98161584-98161606 GAAGTATTAGAAGAAAACACAGG - Intronic
1073508603 10:104025613-104025635 GAAGTATTCTTTAAAATGACTGG + Exonic
1073892766 10:108120015-108120037 GCTATATTGGTGAAAAACACTGG + Intergenic
1074421873 10:113316294-113316316 AGATTAATGGTTAAAAACACAGG + Intergenic
1074799402 10:116984187-116984209 TAAGTATTGGTTGGAAATACTGG - Intronic
1075366756 10:121897252-121897274 GAAGTCTTGAATAAATACACCGG + Intronic
1077310280 11:1885604-1885626 GAAGTATTGGTTGAATAGAAGGG - Intronic
1077974460 11:7233284-7233306 GGAATATTGGTTAAAAAGTCTGG + Intergenic
1078092323 11:8272136-8272158 GAAATATTTTTTAAAAAGACTGG + Intergenic
1078452667 11:11452202-11452224 AAAGAATTGGTTAAGAACACTGG + Intronic
1079927691 11:26515511-26515533 TAAGTATTGTTTAGAAACATTGG + Intronic
1080071166 11:28089019-28089041 GAGGTGATGGTTAGAAACACAGG + Intronic
1080709881 11:34736910-34736932 GAAGAAATGGGTAAAAAGACAGG + Intergenic
1080907626 11:36562520-36562542 GGGGTACTGGTTAAAAACCCAGG - Intronic
1081263952 11:40996090-40996112 GAAGTATTCTTTGAAAATACAGG + Intronic
1082687371 11:56257514-56257536 AAAGTATAGTTTAAAAACAGAGG + Intergenic
1086837987 11:91649672-91649694 AAAGTAGCAGTTAAAAACACAGG + Intergenic
1091841753 12:3626592-3626614 CACGTATTTGTTCAAAACACCGG - Intronic
1096401055 12:51306680-51306702 GAAGAATTGGTAAAATTCACTGG + Intronic
1097636365 12:62127235-62127257 GAAGGATTGGTTTAGAAAACGGG + Intronic
1097724682 12:63061693-63061715 GAAGTATTAGATAAACAAACAGG + Intergenic
1098796809 12:74898918-74898940 GAAAGATTGGATAAAAAGACAGG + Intergenic
1100231734 12:92615641-92615663 GAAGAATTATTTCAAAACACTGG + Intergenic
1101351509 12:103934013-103934035 GAAGAGTTGGTTAAAAACCTTGG + Exonic
1103754240 12:123190692-123190714 TAAATATTGTTTACAAACACAGG + Intronic
1105746787 13:23384661-23384683 GATGTAATGGTGAAAAAAACAGG + Intronic
1107308304 13:39047073-39047095 CAAGTATTTGATAAAGACACTGG + Exonic
1108539611 13:51427760-51427782 AAAGTATTGATTATAAACATTGG - Intronic
1109131548 13:58592685-58592707 GAAGTAATGGTTAGAAACCATGG - Intergenic
1109441564 13:62380612-62380634 GAAGTTTTGTTTAAAAATAATGG - Intergenic
1109914684 13:68966689-68966711 GAATCTTTGGTTGAAAACACAGG - Intergenic
1110624905 13:77643351-77643373 AAAATGTTAGTTAAAAACACAGG - Intronic
1111454973 13:88469429-88469451 AAAATATTTGTAAAAAACACAGG - Intergenic
1111728538 13:92043207-92043229 GAAATAGTGGTTGAAAACAAAGG + Intronic
1111935532 13:94553393-94553415 GAAATATTGATTAAAATCAGAGG - Intergenic
1112935319 13:104790392-104790414 GAAGTATGGGCTAAAAATAAAGG - Intergenic
1116923364 14:50605742-50605764 GAAAAAATGGTTAAAAACAGTGG - Intronic
1117744020 14:58849102-58849124 GGTGTACTGGTTAAAAACCCAGG - Intergenic
1118422110 14:65617988-65618010 GAATTAATTTTTAAAAACACTGG - Intronic
1118532640 14:66724204-66724226 CAAATATTGGTGAAAAGCACTGG - Intronic
1120621155 14:86766237-86766259 GAAGTATTGGTTAACAGCAGAGG + Intergenic
1122013072 14:98769679-98769701 GATGTATTGGATTAAACCACTGG - Intergenic
1122257063 14:100486281-100486303 TAAGCATTTGTTAAAAATACCGG + Intronic
1125982782 15:44018127-44018149 GAAATATTTGTTCAAAGCACAGG + Intronic
1126346945 15:47705662-47705684 GAAGAATTGGGAAAAAACACTGG - Intronic
1127083255 15:55401059-55401081 GAAGTATTAGTAGAAAATACAGG - Intronic
1127504603 15:59585977-59585999 GAAATAAAGGTTTAAAACACTGG + Intergenic
1127816149 15:62610903-62610925 GAAGTATTGGTGTGAATCACGGG - Intronic
1128587693 15:68864818-68864840 GAAGTATTACTTAAAGACACTGG + Intronic
1132129084 15:99258089-99258111 GAAGAGTTGGTTAAAAACCTTGG + Intronic
1135716292 16:24771396-24771418 GAAGTATAGGTTCAAAAGACTGG - Intronic
1137483378 16:48871062-48871084 GAAGTATTTGCTATAGACACAGG + Intergenic
1140716826 16:77734194-77734216 GTTGTACTGATTAAAAACACAGG + Intronic
1141253750 16:82382111-82382133 GAAGCATTTGTCAGAAACACAGG - Intergenic
1142073290 16:88103190-88103212 GGCTTTTTGGTTAAAAACACTGG + Intronic
1142691414 17:1608136-1608158 GAAGTTTTGTTTACAAAAACAGG + Intronic
1144085165 17:11801905-11801927 TAAGTACTGGCTACAAACACTGG + Intronic
1145725613 17:27120293-27120315 GAAGTTTTAGTTAAAAAAAAGGG + Intergenic
1146150401 17:30463810-30463832 AACTTAGTGGTTAAAAACACAGG + Intronic
1149240995 17:54648948-54648970 GAAGTATTCCTTAAAAGCAAAGG + Intergenic
1149811251 17:59675156-59675178 GAATTAGTTGTTAAATACACAGG - Intronic
1150004401 17:61461044-61461066 GAAGTAAGGGTTGAAGACACTGG + Intronic
1153346485 18:4031578-4031600 GAACCATTTGTTAAAACCACAGG + Intronic
1153725318 18:7948066-7948088 TAAGTATTAGTAAAAAACAATGG - Intronic
1155350469 18:24901003-24901025 GAAGGAATGGTCAAAAACATTGG - Intergenic
1157385434 18:47256105-47256127 GAAATATTGTTTATAAACAAGGG + Intergenic
1157714743 18:49876105-49876127 GAACAAATGGATAAAAACACAGG + Intronic
1158013648 18:52758490-52758512 TAATTATTTTTTAAAAACACAGG - Intronic
1158455595 18:57604554-57604576 TAAGTAATGGTTAAATGCACAGG + Intronic
1158901935 18:61972049-61972071 GATGAATTGCTTAAAAACGCTGG - Intergenic
1159085521 18:63785404-63785426 GAAGGATTGTTTAAAAAGATTGG - Intronic
1159147857 18:64478010-64478032 AAAATAGTGGTTAAAAACATGGG - Intergenic
1163452884 19:17389663-17389685 GCAGTGTAGGTTAAAAACATGGG + Intergenic
1165116320 19:33531127-33531149 GGAGTGTTGGTTAAAAATCCAGG - Intergenic
925361778 2:3285034-3285056 GGAGAAGTGGTTAAATACACAGG + Intronic
925881979 2:8360395-8360417 CAAGTATTTATTAAAAACATGGG - Intergenic
928289568 2:30025573-30025595 GAAGAGTTTGTTAAAAATACCGG + Intergenic
929970142 2:46567009-46567031 GAAGTATTTGTTATAAAAATGGG - Intronic
930209641 2:48621450-48621472 TAATTATTGATTAAAAACTCAGG + Intronic
930730010 2:54719984-54720006 GGAGTAGTGGTTAATAACACTGG + Intergenic
931000153 2:57770650-57770672 ACAGTATTGCTTAAAAACAATGG - Intergenic
932199637 2:69814064-69814086 TATGTATTGGTTAAGAATACTGG - Intronic
932514435 2:72330485-72330507 TAAGTTTTGTTTAAAAACATGGG - Intronic
933859498 2:86450778-86450800 TTAGAACTGGTTAAAAACACAGG + Intronic
934051759 2:88217138-88217160 GAAGAATTGGTTAAAAATTATGG - Intergenic
936748185 2:115606691-115606713 GAAGTCAAAGTTAAAAACACAGG + Intronic
937234462 2:120422117-120422139 GAAGAACTGGTTAAAAAAAAGGG + Intergenic
939994767 2:148909505-148909527 CAAGTACTGTTCAAAAACACTGG - Intronic
940367499 2:152864500-152864522 GAAGTATTTTTTAAAATCAATGG - Intergenic
941274770 2:163477552-163477574 CAAGTATGAGTTAAAAACTCTGG + Intergenic
941692777 2:168518645-168518667 GAGGTATTGGTTGAAACCAAGGG - Intronic
941792921 2:169572880-169572902 GAAGTAATGGTTAGAAAAGCAGG + Intronic
942068854 2:172297368-172297390 GATGTAGTGGTTAAAAGCATGGG + Intergenic
942806941 2:179941919-179941941 GAAGTAGTGGTATAAGACACAGG + Intergenic
943650364 2:190451400-190451422 CAAGTATTTATTAAACACACTGG + Intronic
944547067 2:200809605-200809627 GAAGTAAAGGTGAAAAACATTGG + Intergenic
948759354 2:240180998-240181020 GAAGGAATGATTTAAAACACAGG - Intergenic
1169879603 20:10332134-10332156 GAAGAATGGCTTAAACACACAGG + Intergenic
1174266106 20:49333435-49333457 GAAGTATTGGTTTAGATAACCGG + Intergenic
1175006850 20:55692929-55692951 GAAATATTTGTTATAAACATTGG + Intergenic
1175055938 20:56198151-56198173 AGGGTAATGGTTAAAAACACAGG + Intergenic
1176865904 21:14055012-14055034 GAAACATTGGTCAAATACACAGG - Intergenic
1178151976 21:29805430-29805452 GATTTATTGGCTAATAACACTGG - Intronic
1181548890 22:23624342-23624364 GAAGAAATGATCAAAAACACAGG + Intronic
1183018624 22:35009644-35009666 GGAAAACTGGTTAAAAACACAGG + Intergenic
1183957444 22:41389731-41389753 GAAGTGTTGGTTGAAATTACAGG + Intronic
1185197401 22:49480776-49480798 CAATTATTTATTAAAAACACAGG - Intronic
950249237 3:11450253-11450275 AAAGTAGTAGTTAAGAACACAGG - Intronic
953682083 3:45047087-45047109 GAAATTTTTCTTAAAAACACTGG - Intergenic
955588061 3:60503040-60503062 GCTGTATTGGTTAAGAACATAGG + Intronic
957741198 3:84271201-84271223 GAAATAATGGTTAGAATCACTGG + Intergenic
959856009 3:111160011-111160033 TAAGGAATGGTTAAAAACAATGG - Intronic
959866484 3:111276307-111276329 GAAGTTTTGGTGGAAAACATAGG + Intergenic
962059976 3:131915189-131915211 TAAGAATTGGTCAAAAACACAGG - Intronic
962728066 3:138253446-138253468 GATGTAATAGTTAAAAACATAGG - Intronic
963174565 3:142284327-142284349 GAATTATTGGTAAAATACAAGGG + Intergenic
964779911 3:160325338-160325360 AAAGTATGGTTTTAAAACACTGG + Intronic
965068259 3:163880712-163880734 GGAATATTGGTTAGAACCACAGG - Intergenic
965362949 3:167763684-167763706 GAAATATCCGTTAAAAATACAGG + Intronic
965422444 3:168478833-168478855 GAACTTTTGGATAAAAACTCAGG - Intergenic
966567578 3:181400297-181400319 GATGTATTTGATTAAAACACAGG - Intergenic
967117042 3:186351397-186351419 TAACTACTGGTTAAAAATACTGG + Intronic
967354775 3:188556216-188556238 TAAATATTGGTTAAATACAAGGG + Intronic
967813237 3:193778061-193778083 GAAGTCTTGTTTAAAAGCCCTGG - Intergenic
968241617 3:197093593-197093615 GAAGTAAAGGTTAAAAATAAAGG - Intronic
968385381 4:131781-131803 AGAGAATTGCTTAAAAACACAGG + Intronic
969635512 4:8367169-8367191 AAAGTTTTTGTTAAAAACACAGG + Intronic
971282971 4:25256942-25256964 AAAGTAATGGGTAAAACCACAGG + Intronic
971760151 4:30755501-30755523 GAAGTATTTGTTGAGAAAACAGG - Intronic
974734984 4:65918682-65918704 GAATGATTTGTTAAAAACAATGG - Intergenic
975377644 4:73664514-73664536 GAAGCAATGGTTTAAAACAATGG - Intergenic
979427910 4:120590991-120591013 GAGCTAGTGGTTAAAAAAACAGG + Intergenic
981173083 4:141647454-141647476 GAATTATTGGTTAAAACAAATGG + Intronic
982231628 4:153213253-153213275 CACATAATGGTTAAAAACACAGG - Intronic
982376554 4:154697192-154697214 GAAGTATTGTTTAAAGAGACAGG + Intronic
982512716 4:156303768-156303790 GAAGTTTTTGTTAAATAGACAGG - Intergenic
983684539 4:170392593-170392615 CAAGTATTGCCCAAAAACACTGG + Intergenic
984114060 4:175657253-175657275 GAAGCTTTGTTTAAAATCACAGG - Intronic
984125044 4:175797902-175797924 AGATTATTGGTTAAAAACCCTGG - Intronic
984384863 4:179043623-179043645 CAAATATTAGTTAAAAACGCAGG - Intergenic
988606594 5:32683902-32683924 GAAGTTCTGGTTAAGAAGACTGG + Intergenic
989307734 5:39977063-39977085 AAAGTAGGGGTTAAAATCACTGG + Intergenic
990803394 5:59631298-59631320 GAAGAAATAGTTAAGAACACAGG - Intronic
991612719 5:68465610-68465632 GAATAAAGGGTTAAAAACACAGG - Intergenic
992393248 5:76348698-76348720 GCAGTAATGGTTAAGAACATGGG + Intronic
992866703 5:80963622-80963644 GCAGTATTTATTACAAACACTGG - Intronic
994966035 5:106672102-106672124 GATGAATTGGTTAAAAAAATTGG + Intergenic
995662218 5:114497958-114497980 CAAGCATTTGTTATAAACACTGG + Intergenic
996949236 5:129105690-129105712 AAAGTAGTAGTTAAAAATACAGG - Intronic
998885469 5:146689329-146689351 GATGTTTTGGTCAATAACACTGG + Intronic
1000123131 5:158217175-158217197 AAAGTAAAGGTTAAAAACACAGG - Intergenic
1001117814 5:168954375-168954397 CAATTATTTGTTAGAAACACTGG + Intronic
1003934257 6:10959149-10959171 GAAATATATGTTAAAAATACAGG + Intronic
1004838446 6:19555352-19555374 AAAGCATTAGTTTAAAACACCGG - Intergenic
1006557443 6:34879940-34879962 GTAGTGTTGGTTACAAATACTGG - Intronic
1007033370 6:38649771-38649793 GGGGTATTTGTTAAAAACACAGG - Intergenic
1008434890 6:51464518-51464540 GAACTATTGGTAATAAACAGAGG + Intergenic
1008818747 6:55605181-55605203 GAAGGAAAGGGTAAAAACACTGG + Intergenic
1012993531 6:105949815-105949837 GAATCACTGGTTAAAAACAAAGG + Intergenic
1013214390 6:108014486-108014508 TAAGAATAGGTTGAAAACACAGG - Intergenic
1013347705 6:109278069-109278091 GAGGTAATGGAGAAAAACACTGG - Intergenic
1013572555 6:111444140-111444162 GAAGTATTGGTTAAAAACACAGG + Intronic
1013697967 6:112726611-112726633 AAAATAATGGTTAAAAACTCTGG - Intergenic
1015201382 6:130585358-130585380 GAAGTATTGGATGAAAAGGCTGG - Intergenic
1016888453 6:148981578-148981600 GAAGTACAGGTGAAAAAGACAGG - Intronic
1017612783 6:156208677-156208699 AAAGCATTGGTTAAAAACTAAGG + Intergenic
1017616212 6:156249618-156249640 GGAGAATTGCTTAAAAACCCAGG - Intergenic
1017697176 6:157028098-157028120 GAAGTATTGCTTAAATAAAATGG + Intronic
1022260198 7:28696467-28696489 GAAGAAATGGTACAAAACACTGG - Intronic
1022431379 7:30325465-30325487 GAATTATTGGTTAAATAAAAAGG + Intronic
1022587649 7:31629884-31629906 GAAGTCTTGCTTAAAAGGACAGG + Intronic
1024378076 7:48662081-48662103 GAGGTCTTTGTTAAAAACAAGGG + Intergenic
1028159862 7:87473845-87473867 AAAGTATTGACTAAAATCACTGG + Intronic
1031662232 7:124439678-124439700 GATGTAATGGCTAAGAACACTGG + Intergenic
1032299111 7:130670135-130670157 GAAGTTTTGTTTAATACCACAGG + Intronic
1033298859 7:140167664-140167686 CAAGTATTAGAAAAAAACACAGG + Intronic
1036547377 8:9784936-9784958 GAAGTAATGCGTAAAAAAACAGG + Intergenic
1037586037 8:20276702-20276724 GAAGTATTGGTGAAACAACCTGG + Intronic
1038097799 8:24335231-24335253 GAAATATTGCTTAAAAACTTAGG + Intronic
1039438078 8:37574709-37574731 GATGTAGTGGTTAAGACCACAGG + Intergenic
1041092298 8:54314433-54314455 GAATTATGCTTTAAAAACACAGG + Intergenic
1041272578 8:56123480-56123502 GAAGTGTAAGTTAAAAGCACAGG - Intergenic
1041573769 8:59369643-59369665 GAAGGATTAGTTCAAATCACTGG - Intergenic
1043538701 8:81234679-81234701 CAATTCTTGGTTTAAAACACAGG - Intergenic
1044483841 8:92726018-92726040 AAAATATTGCTTCAAAACACTGG - Intergenic
1045537197 8:103042043-103042065 GAAGTCTTAGTTTACAACACAGG - Intronic
1045724725 8:105159256-105159278 CAAGAATTCATTAAAAACACAGG - Intronic
1045882285 8:107055430-107055452 GAACTATTGGATTAAAACATTGG + Intergenic
1047752123 8:127889823-127889845 GATGTATCGGCTAAAAACTCTGG - Intergenic
1055259670 9:74418697-74418719 AAAATATCAGTTAAAAACACTGG - Intergenic
1055871833 9:80889770-80889792 TAAGCATTGCTTAAAAACCCAGG + Intergenic
1056769911 9:89469889-89469911 GAAGTCTTGGCTAAAGAAACAGG + Intronic
1057110371 9:92464233-92464255 GAAGTAATGGGTTAGAACACTGG + Intronic
1057771133 9:97968987-97969009 CAAATATTGGTAAAAAACAGAGG + Intergenic
1057838103 9:98463520-98463542 GATGTTTTGGTGAAAAACAATGG + Intronic
1059770447 9:117418784-117418806 GAAGTATTTGCTAGAAAGACTGG - Intergenic
1060451978 9:123751105-123751127 TATGTGTTGTTTAAAAACACTGG + Intronic
1061566583 9:131444755-131444777 GAGGAATGGGTTAAAAATACAGG - Intronic
1187033428 X:15512099-15512121 AATGTATTGGTTAAAAAATCAGG - Intronic
1187294774 X:17988140-17988162 GAATTATTCCTTAAAAACAAGGG - Intergenic
1188467890 X:30503474-30503496 AAAGTATTTGTTCAAAACAATGG + Intergenic
1191076941 X:56464430-56464452 ATAGTATTGGTTAAAAAAAAAGG - Intergenic
1193541477 X:82777888-82777910 GATGTTTTGCCTAAAAACACTGG + Intergenic
1194997623 X:100608967-100608989 GTAATATTGGGTCAAAACACTGG - Intergenic
1195811243 X:108832850-108832872 AAACTATTGGTTAATAACATGGG - Intergenic
1196945659 X:120822778-120822800 CTAGTAGTGGTCAAAAACACAGG - Intergenic
1198464675 X:136894148-136894170 GAAGGAGTGGTTGAATACACAGG - Intergenic
1199182994 X:144879711-144879733 GAAGAATTGGCTAAAATGACAGG + Intergenic
1199833371 X:151564863-151564885 GAAGTTTTGATTGAAAATACAGG - Intronic