ID: 1013575720

View in Genome Browser
Species Human (GRCh38)
Location 6:111482641-111482663
Sequence TCCACGGAGACGGCCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013575720 Original CRISPR TCCACGGAGACGGCCGGCGC CGG Intronic
900180272 1:1308139-1308161 TCCCCGGAGACGGCCGTGGCAGG - Intronic
900237439 1:1599501-1599523 TCCACGCACTCGGCCGGCTCGGG + Exonic
901793057 1:11664487-11664509 TTCACGGAGCCTGCGGGCGCTGG + Intronic
903378186 1:22879489-22879511 TCCACGGGGAGGGATGGCGCTGG + Intronic
903652366 1:24929914-24929936 CCCCCGGGGGCGGCCGGCGCGGG + Intronic
904443674 1:30550634-30550656 TCCACGGAGCCAGCAGGAGCTGG + Intergenic
905202257 1:36322954-36322976 TCCGCGGTGAGGGCGGGCGCCGG - Exonic
907430107 1:54406548-54406570 TCCGCGGAGGCGGCCGCAGCGGG - Intronic
908355667 1:63323302-63323324 CCCAAGGAGGCGGCCGGAGCCGG + Exonic
911266803 1:95753233-95753255 TCCATGGAGCCGGCAGGAGCTGG + Intergenic
915348206 1:155208750-155208772 TCCATGGCGACAGGCGGCGCAGG + Exonic
919302631 1:195790610-195790632 TCCATGGAGCCGGCAGGAGCTGG + Intergenic
920528750 1:206686166-206686188 TCCCCGGAGCCGCCCCGCGCGGG - Intronic
922496420 1:226061946-226061968 TGCACGCAGGCGGCCGGCCCAGG + Intronic
923744344 1:236686582-236686604 CCCACGGAGGCGGCGGGCGGCGG - Exonic
924240101 1:242032169-242032191 TCCACTGAGACTGCTGGCACTGG - Intergenic
1065588863 10:27245965-27245987 TCCACAGAGGCAGCCGGCGGAGG - Intergenic
1076782034 10:132729680-132729702 TCCACGCAGAGGGCCAGTGCTGG + Intronic
1083943361 11:65910612-65910634 TCCATGGAGATGGCAGGGGCCGG + Intergenic
1084568231 11:69943697-69943719 TCCTCGGAGACTCCCGGCACTGG - Intergenic
1088355558 11:108940430-108940452 TTCAAGGAGAAGGCAGGCGCAGG - Exonic
1088894013 11:114064378-114064400 TCCATGGAGACAGCCAGGGCAGG - Exonic
1101086147 12:101239014-101239036 TCCATGGAGTCGGCAGGAGCCGG + Intergenic
1113653383 13:112053806-112053828 TCCACCCAGACGGCCGGCTGTGG + Intergenic
1115566613 14:34630123-34630145 TCCGAGGCGAGGGCCGGCGCAGG + Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119266278 14:73264770-73264792 TCCACTGAGACCCCCGGCCCTGG - Intronic
1127417531 15:58771726-58771748 TCCCCGGAGACAGCCGTGGCCGG + Exonic
1132598250 16:762843-762865 TCCAGGGAGAAGGCAGGGGCAGG - Intronic
1132645871 16:999048-999070 TCCACGGAGCAAGCCGGCACGGG + Intergenic
1132873238 16:2124764-2124786 TCCAGTGAGGCGGCCAGCGCGGG - Intronic
1134552325 16:15143943-15143965 TCCAGTGAGGCGGCCAGCGCGGG - Intergenic
1142596261 17:1031484-1031506 TCCACGGAGGGGGCGGGAGCGGG + Intronic
1146143374 17:30388667-30388689 TCCACTGAGTCGGCGGGAGCTGG - Intronic
1147620778 17:41865276-41865298 AGCATGGAGACGGCCGCCGCCGG - Exonic
1151559134 17:74861461-74861483 GCGAGGGAGGCGGCCGGCGCGGG - Intronic
1152279586 17:79377599-79377621 TCCACGGTGACAGCCGGAGCAGG + Intronic
1153139510 18:1955066-1955088 TCCACGGAGCTGGCAGGAGCCGG - Intergenic
1156602882 18:38631008-38631030 TCCAGGGAGAGGGCTGGCGGGGG - Intergenic
1160853387 19:1205534-1205556 TCCTCGGAGACGCCCGTCACGGG - Intronic
1161558536 19:4957892-4957914 TCCACCGGGACTGCCGGCTCTGG - Intronic
1164834884 19:31350202-31350224 TCCAGGGAGGAGGCGGGCGCGGG + Intergenic
1165311003 19:35029719-35029741 CCCACGGAGAGGGGCGGGGCAGG + Intergenic
1166179360 19:41095977-41095999 GCCAGGGAAACGGCCGGGGCAGG + Exonic
1166790991 19:45398314-45398336 TCCATGGTGCCGGCCGGAGCGGG + Exonic
1167391262 19:49196648-49196670 TCCAGGGAGCCGGGCGGCGCCGG - Exonic
935137672 2:100321866-100321888 TTCGGGGAGGCGGCCGGCGCGGG + Exonic
937167662 2:119836530-119836552 TCCACGGAGCCTGCGGGAGCTGG + Intronic
940612341 2:156006971-156006993 TCCATGGAGCCGGCAGGAGCTGG - Intergenic
943965453 2:194327388-194327410 TCCACGGAGCCAGCAGGAGCTGG + Intergenic
948676304 2:239598904-239598926 TCCACGGGAACGGCTGGGGCAGG - Intergenic
1175927172 20:62476468-62476490 TCCATAGGGACGGCCGGCTCGGG + Intergenic
1180096087 21:45555725-45555747 TCCACGCGAACGGCGGGCGCTGG + Intergenic
1180179103 21:46110024-46110046 TCCACGGAGCCAGCAGGAGCCGG - Intronic
1180733856 22:18001344-18001366 TCCCCGGGGACGGTTGGCGCGGG + Intronic
952269477 3:31817486-31817508 TCCACGGAGCAGGCAGGAGCCGG - Intronic
960944999 3:122960021-122960043 TCCACGGAGAGAGCCTGCCCAGG - Intronic
963483187 3:145903621-145903643 TCCACGGAGCCTGCAGGAGCTGG + Intergenic
966787835 3:183636445-183636467 TCCCCGGGGACGGCCGCAGCGGG - Intronic
969728217 4:8938397-8938419 TCCAGGGAGCCGGTCGGAGCTGG - Intergenic
994099573 5:95878532-95878554 TCCAGGAAGACGGAGGGCGCTGG + Intergenic
994891185 5:105639229-105639251 TCCACGGAGCCAGCTGGAGCTGG + Intergenic
1013575720 6:111482641-111482663 TCCACGGAGACGGCCGGCGCCGG + Intronic
1015455758 6:133424667-133424689 TCCATGGAGAAGGCAGGAGCTGG - Intronic
1019294599 7:267109-267131 CCCACGGAGATGGGCGGGGCAGG - Intergenic
1019299288 7:295481-295503 TCCACGGGGACGCCCAGCTCAGG - Intergenic
1021163057 7:17299169-17299191 ACCACTGCGGCGGCCGGCGCCGG - Exonic
1024678421 7:51658899-51658921 TCCTCTGACACGGACGGCGCAGG + Intergenic
1026787059 7:73308461-73308483 CGCACGGAGGAGGCCGGCGCTGG + Exonic
1029110868 7:98212429-98212451 TCTGCGGAGCCGGCCGGCCCGGG + Exonic
1030359347 7:108579325-108579347 TCCATGGAGACTGCAGGAGCCGG + Intergenic
1033644118 7:143288042-143288064 TTCACGGAGACGGGCGTGGCTGG - Exonic
1034411803 7:150945963-150945985 GCCAGGGAGAGGGCCGGGGCAGG + Intronic
1034659994 7:152760233-152760255 ACCCCGGCGACGGCCGGAGCCGG - Intronic
1038543924 8:28411693-28411715 TTCCCGGCGGCGGCCGGCGCGGG - Intronic
1038816709 8:30912170-30912192 TGCAGCGAGACAGCCGGCGCAGG + Intergenic
1040391555 8:46954853-46954875 TCCAGGGTGATCGCCGGCGCAGG + Intergenic
1041965584 8:63670689-63670711 TCCAGGGAGACGGTGGGAGCTGG - Intergenic
1045300865 8:100908676-100908698 TCCACGGAGCTGGCGGGAGCCGG - Intergenic
1049784659 8:144444576-144444598 TCGACGGCGGCGGCGGGCGCGGG + Intergenic
1053202703 9:36163563-36163585 TCCGGGGAGGCGGCCGGGGCAGG + Exonic
1055989106 9:82086122-82086144 TTCAAGGAGAAGGCAGGCGCAGG + Intergenic
1060754975 9:126206027-126206049 TTCAGGGAGACGCCCAGCGCTGG - Intergenic
1200163291 X:154019871-154019893 TCCGCGGACCCGGCCGGCCCAGG - Exonic