ID: 1013577160

View in Genome Browser
Species Human (GRCh38)
Location 6:111494975-111494997
Sequence CATCAAATGATCAATGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013577160 Original CRISPR CATCAAATGATCAATGTAGA GGG (reversed) Intergenic
900871195 1:5304614-5304636 CATTAAATGATCCATCTGGAAGG - Intergenic
902061917 1:13651532-13651554 CATCAAAGGATAAATGCATATGG + Intergenic
902083120 1:13834959-13834981 CCCCAAATCATCAATGTAAAGGG - Intergenic
902353405 1:15876908-15876930 AATTAAATGATCAAAGTGGAAGG + Intronic
904401301 1:30258276-30258298 CATAAAATGATCTCTGGAGAAGG - Intergenic
905088837 1:35410053-35410075 CATCATATGATCATGGCAGAAGG + Intronic
908835485 1:68225271-68225293 CATAAAATGATGAATCTAAAAGG - Intronic
909942009 1:81621995-81622017 CTTCAAATGATAACTGAAGACGG - Intronic
910502697 1:87911002-87911024 CCTCAAATGATTAATGGAGCTGG - Intergenic
913310859 1:117491160-117491182 CAACAGATTTTCAATGTAGATGG + Intronic
917061925 1:171050596-171050618 CATCATATCATCAGTGAAGAGGG + Intronic
917123050 1:171661085-171661107 CATCACATGACCAATAAAGAAGG - Intergenic
919151740 1:193709690-193709712 CATCAAAAGATCAGTGTACTGGG + Intergenic
920783395 1:209016690-209016712 AATCCAATGATAAAAGTAGAGGG - Intergenic
923761527 1:236849593-236849615 CACCAAAGGAGCAATGTAGGAGG + Intronic
923866051 1:237940683-237940705 CATCAAATGATATATGTTAAGGG + Intergenic
1064495778 10:15908585-15908607 AAACAAATGCTCAATGTAGTAGG + Intergenic
1064675736 10:17758279-17758301 CATCAAATCATGAATGTTCAGGG - Intronic
1065530620 10:26666195-26666217 TATCTAATGATAAATGTTGAGGG + Intergenic
1067150034 10:43724243-43724265 AAAGAAATGAACAATGTAGAAGG + Intergenic
1067973056 10:50992909-50992931 CAGCAAATGATCTAAGAAGAGGG - Intronic
1069122218 10:64580967-64580989 CTTCAAATGATCAGTTGAGAAGG + Intergenic
1070957280 10:80472636-80472658 AGTTAAATGATAAATGTAGAAGG - Intronic
1073058907 10:100721380-100721402 GATCAAATGATGAATGTGAAAGG - Intergenic
1076111792 10:127865387-127865409 CAGCAAATTATCAAACTAGAGGG + Intergenic
1076127619 10:127987818-127987840 CTTCAAATGAAAAATGAAGAGGG - Intronic
1080144199 11:28960138-28960160 CAAAAAATGATCAATTTAGATGG - Intergenic
1082724897 11:56722716-56722738 ATTCAAATGTTAAATGTAGATGG + Intergenic
1083166942 11:60895214-60895236 CAACAGATTTTCAATGTAGACGG - Intronic
1084995411 11:72972689-72972711 CATAAAATAACCAATGTAGCAGG + Intronic
1085841024 11:80012099-80012121 AATCAAATGATCGATGTTTAGGG + Intergenic
1085951805 11:81341486-81341508 CATTAAAGGATAAATGCAGAAGG - Intergenic
1086770431 11:90757391-90757413 AATAAAATTATCAATGAAGAAGG + Intergenic
1086845305 11:91742625-91742647 CATTAAATGACCAATGTGGTCGG + Intergenic
1088065198 11:105709329-105709351 CTTCCAATGAATAATGTAGAAGG + Intronic
1091248808 11:134124123-134124145 CATCAAATGGCCAATCTAGAAGG + Intronic
1093259691 12:16919916-16919938 CATCAACTGATGAATGAATAAGG + Intergenic
1095526291 12:43129666-43129688 AATCAATTGATCTATTTAGAAGG - Intergenic
1097307290 12:58083615-58083637 TAGCAACTGATCAATCTAGAAGG - Intergenic
1100921682 12:99495232-99495254 CATCAAATCATCAACCTAGCAGG + Intronic
1101477951 12:105068787-105068809 CATCACATGATCTCTGAAGAAGG + Exonic
1102750871 12:115292843-115292865 CATCAATGGATCAATGGACATGG - Intergenic
1104173650 12:126307236-126307258 AATCATATCATCAATGAAGAGGG + Intergenic
1105933077 13:25070494-25070516 CTTCAAATTGTCATTGTAGAGGG + Intergenic
1107472735 13:40705382-40705404 ATTCCAATAATCAATGTAGAAGG + Intergenic
1109170631 13:59092953-59092975 TATCAAAAGATGACTGTAGAAGG - Intergenic
1110128253 13:71975459-71975481 CATCAAAAGATGAATGGATAAGG - Intergenic
1111838550 13:93420619-93420641 CATCTAATGTTCATTTTAGAAGG + Intronic
1112081822 13:95980611-95980633 AAACAACTGATCAAAGTAGATGG + Intronic
1112833765 13:103487744-103487766 CATCAAATGACCAATGTGCAAGG - Intergenic
1112957749 13:105082146-105082168 AATCAAGTGAGCAATGTAAATGG - Intergenic
1112967562 13:105216321-105216343 CAATAAATGATCAATGTTTAAGG - Intergenic
1115761912 14:36583719-36583741 TAGAAAATGATCAATGTAGGAGG + Intergenic
1116713116 14:48394910-48394932 CATCAAATAATGACTGCAGAGGG + Intergenic
1120117017 14:80631173-80631195 CATCAGATTCTCAATGGAGATGG - Intronic
1120496597 14:85245405-85245427 CATCAGAAAATCAATGGAGATGG - Intergenic
1120583545 14:86283687-86283709 CATGAACTGATGAAAGTAGATGG - Intergenic
1121642116 14:95492368-95492390 CATCAACTGATAAATGGATAAGG + Intergenic
1126761796 15:51976330-51976352 CAGAAAATGATCAGTGAAGATGG + Intronic
1129495023 15:75971287-75971309 CATCTCATGATCTCTGTAGAAGG + Intronic
1129941458 15:79500687-79500709 CATCACATGAGCACTGTAGTGGG + Intergenic
1132217415 15:100075758-100075780 GATCAAATGAGCACTGCAGAAGG - Intronic
1133377200 16:5297140-5297162 CATCAAAAGATAAATGGATAAGG - Intergenic
1133962856 16:10509793-10509815 CATCAACAGATTAATGTGGATGG + Intergenic
1137421353 16:48337425-48337447 GATTAAATGATCACTGTGGAGGG - Intronic
1137551391 16:49439999-49440021 CATCTAATGGTCAATGTTGGGGG + Intergenic
1138442781 16:57045254-57045276 AATCAAATGAGAAATGTCGATGG + Intronic
1140331358 16:74060311-74060333 CATTAAAAGATTAATGTAGTCGG - Intergenic
1142535691 17:616401-616423 CAACAACTGAACAATGAAGAGGG + Intronic
1145825809 17:27876558-27876580 CAGTAAATGGTCAATGAAGATGG + Intronic
1147032833 17:37654624-37654646 TATCAACTAATAAATGTAGAAGG + Intergenic
1153839910 18:8997733-8997755 CAACAATTGATCAATGGATATGG - Intergenic
1155316641 18:24578263-24578285 CACCAAATGTTCAAGGTTGATGG - Intergenic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157983813 18:52414495-52414517 CCTCAAATGGCCAAAGTAGATGG + Intronic
1159128054 18:64247760-64247782 GATCAAAAGATCAGTGTAGCTGG - Intergenic
1159730078 18:72015070-72015092 CTTCAAATGAAACATGTAGATGG - Intergenic
1159991102 18:74908848-74908870 CAAAAAATGTTCAAAGTAGAGGG - Intronic
1163917938 19:20259035-20259057 CCTCACTTGATCAATGTTGAAGG + Intergenic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1166866269 19:45839467-45839489 TGTCAACTGATAAATGTAGAAGG + Intronic
924961023 2:34830-34852 CATAAAATGATCCTTGCAGATGG + Intergenic
925079303 2:1049925-1049947 CATCAAATGATTCATACAGATGG - Intronic
926451696 2:13012059-13012081 CATCAAAGGATGAATGGATAAGG - Intergenic
927464357 2:23325775-23325797 CCCCAAAGGCTCAATGTAGAGGG - Intergenic
928269919 2:29846799-29846821 CATCAAAAGATGTATGTAAAAGG - Intronic
929199658 2:39221309-39221331 CATAAGATCATCAATGTGGACGG - Intronic
931742643 2:65261313-65261335 CCTCACTTGATCAATGTTGAAGG + Exonic
932177833 2:69619020-69619042 AATCAAAGGAGCAGTGTAGATGG - Intronic
933314007 2:80694135-80694157 AATCAAATCATCTATGTAGGAGG + Intergenic
934153672 2:89174275-89174297 CATGATATGATCAAAGTAAAGGG - Intergenic
934213562 2:90007657-90007679 CATGATATGATCAAAGTAAAGGG + Intergenic
935498797 2:103812806-103812828 CATCAAATAATCAATGTTGTAGG + Intergenic
937162747 2:119780932-119780954 TATCTAATGATAAATATAGAAGG - Intronic
937825109 2:126360355-126360377 GATCAAATGATCAATTTAACAGG - Intergenic
937950699 2:127385603-127385625 CAACAAATGTTTAATCTAGAGGG + Intronic
938583163 2:132666303-132666325 CATCAAAAGAGCAATGTCCAGGG - Intronic
939560156 2:143722386-143722408 CTTCAAATGATAAATTTTGAAGG - Intronic
940462801 2:153988554-153988576 CATCAAAAGATAAATGGATAAGG - Intronic
944345205 2:198656394-198656416 CATAAATTGATCAATGAAAAAGG - Intergenic
1169613075 20:7405414-7405436 CATTAAATTTTCAATGTAGCAGG - Intergenic
1169636326 20:7696085-7696107 CATCAAGTGAACAAGCTAGAAGG - Intergenic
1169682410 20:8230376-8230398 CAAAAAATGATAAATGTTGAAGG - Intronic
1170083764 20:12506300-12506322 CATCAAATTTTCAAAGTAGAGGG + Intergenic
1173364871 20:42376073-42376095 CAGCAAATGATCACAGTGGATGG + Intronic
1178818135 21:35950376-35950398 CATCAGATGATACATGTAAATGG + Intronic
1179154141 21:38835185-38835207 CATCAAGAGGTCCATGTAGAAGG + Intergenic
950268569 3:11594215-11594237 CATCAAATGATCACTGGTGTTGG + Intronic
952234525 3:31464878-31464900 CATCAAAGGATCAAGGAAGCTGG - Intergenic
952515600 3:34101734-34101756 CAACAGATTTTCAATGTAGATGG - Intergenic
953345761 3:42174029-42174051 CATAAAATAATCCATATAGAGGG + Intronic
957160124 3:76600336-76600358 TTTCAAATCATTAATGTAGAAGG - Intronic
959472558 3:106770452-106770474 CAGGAAATGATCAATGGAGAAGG - Intergenic
959981357 3:112521490-112521512 CATCAAAAGATGAATGGATAAGG - Intergenic
960045875 3:113197668-113197690 TTTCAAATAATAAATGTAGAAGG - Intergenic
961220758 3:125197775-125197797 AACCAAATGATCCATGTGGAAGG + Intronic
961996966 3:131256225-131256247 GATGAAATGATGAATGTATAAGG + Intronic
964583575 3:158269445-158269467 CGTCAAATGAGTAAGGTAGAAGG - Intronic
965677430 3:171212610-171212632 AATCAAATGATAAATGTGGGTGG - Intronic
972913050 4:43842224-43842246 GATGAAAATATCAATGTAGAAGG + Intergenic
974549492 4:63352521-63352543 CATCTAATGATCAGTGTATTTGG - Intergenic
975603586 4:76129092-76129114 CAACAAATGATAAATGTATGGGG + Intronic
975732830 4:77354301-77354323 CATCAAATGCTCACTCCAGAGGG + Intronic
975734421 4:77367397-77367419 CATCAAATGCTCACTCCAGAGGG + Intronic
978089439 4:104696290-104696312 CACAAAATGATAAATGTAGTTGG - Intergenic
978468709 4:109037815-109037837 CATCAAATGACCTATGTGAACGG + Intronic
978602833 4:110446708-110446730 CATCCACTCATAAATGTAGAAGG - Intronic
979163680 4:117497370-117497392 CATCAAATGAGGTAGGTAGAGGG - Intergenic
979338509 4:119491811-119491833 CATCAAAGGATGAATGAATAAGG - Intergenic
983300936 4:165924680-165924702 CAACATATTTTCAATGTAGATGG + Intronic
992596813 5:78355661-78355683 CTACCAATGATCAATGTACAAGG - Intergenic
994086105 5:95761072-95761094 CATCAAATAATCTAAATAGATGG - Intronic
996241733 5:121212251-121212273 CATCAACAGATGAATGTATAAGG - Intergenic
996360683 5:122642226-122642248 CATGAAATGAGCAATGTGAATGG + Intergenic
997030620 5:130123482-130123504 CATCAAATTATCATAGGAGAAGG - Intronic
997421534 5:133771664-133771686 CATCATATCATCAATGAACAGGG + Intergenic
998188779 5:140004260-140004282 CTACAATTAATCAATGTAGAAGG + Intronic
998469490 5:142372390-142372412 AATGAAATAATCCATGTAGAGGG + Intergenic
999595315 5:153197037-153197059 CATCATATGAGCAATGGAGAAGG + Intergenic
1000610966 5:163373880-163373902 TATCACATGATCAACTTAGATGG + Intergenic
1001073939 5:168610051-168610073 CATTAAATGCTCACTTTAGAAGG + Intergenic
1001174604 5:169455534-169455556 CATAAAGTGATCATTGTCGATGG - Intergenic
1004028833 6:11846263-11846285 CACTAAATGACCAATGTAGATGG + Intergenic
1004826470 6:19426788-19426810 GATCAATTGCCCAATGTAGATGG - Intergenic
1006700775 6:35971450-35971472 CATCAATTGCTCCATGTACAGGG + Intronic
1007309701 6:40935541-40935563 CTTCAAAGGATGAATTTAGAAGG + Intergenic
1010332136 6:74635622-74635644 CATCCAAAGACCAATGTAGAAGG - Intergenic
1010870560 6:81032180-81032202 CTTCAAATGATAAACGTTGAAGG + Intergenic
1011423020 6:87194228-87194250 GATTAAATGATAAATATAGAAGG + Intronic
1012456780 6:99415721-99415743 CAGGAAAGGATCAATCTAGAAGG - Intronic
1012672363 6:102070443-102070465 CATTAAATTATCAATGTGCAAGG - Intergenic
1013230012 6:108154148-108154170 AATCAAATGGTCAATGTGGCCGG + Intronic
1013577160 6:111494975-111494997 CATCAAATGATCAATGTAGAGGG - Intergenic
1014000602 6:116361854-116361876 CATCAACTGATTAATGAAAAGGG + Intronic
1014002243 6:116377515-116377537 CTTTAAATGAGCAATGTATATGG - Intronic
1014234497 6:118939477-118939499 CACTAAAAGATCAATGAAGAGGG + Intergenic
1014309080 6:119776783-119776805 CATCAAAAGATCTATATTGAGGG - Intergenic
1014512821 6:122345401-122345423 AGTCGAATGATTAATGTAGATGG - Intergenic
1014759974 6:125345688-125345710 CATCAAATGTTGAAAATAGAAGG + Intergenic
1016058478 6:139603438-139603460 TATCACATGATTAATGTAAATGG + Intergenic
1016455742 6:144228883-144228905 CATCAAATGAGCAATTCAGCAGG - Intergenic
1017024888 6:150172980-150173002 CATCACATCATCAATGAAGAGGG - Intronic
1018295794 6:162341972-162341994 CATTAAATTAACATTGTAGAGGG + Intronic
1018307556 6:162473613-162473635 CAACAAATAATCAATATAGGAGG + Intronic
1021354240 7:19634523-19634545 CATCAAAAGATGAATGCATAAGG + Intergenic
1021405148 7:20258194-20258216 CTTCAAATGTTGAATGTAGGTGG - Intergenic
1022157109 7:27671700-27671722 ACTTAAATCATCAATGTAGATGG + Intergenic
1022560873 7:31347642-31347664 AATTAAATGATCAATGTCAATGG + Intergenic
1022995064 7:35747028-35747050 CATCACCTGAGCAATGTACACGG - Intergenic
1029049978 7:97675603-97675625 CAACAGATTTTCAATGTAGAGGG + Intergenic
1034328683 7:150262701-150262723 CATAAAATGTTAGATGTAGATGG - Intronic
1034764532 7:153706687-153706709 CATAAAATGTTAGATGTAGATGG + Intergenic
1036594988 8:10203351-10203373 CATAAAATGATCATTGAAAATGG - Intronic
1037387545 8:18359474-18359496 CAACAAATGATAAATGTTTATGG + Intergenic
1042043199 8:64617383-64617405 TATCAACTGATAAATGCAGATGG - Intronic
1044771338 8:95638050-95638072 CATCAAACAATAAATGTACAGGG + Intergenic
1044896810 8:96901165-96901187 CATCTAATGATCAATTCAGATGG + Intronic
1044945716 8:97386990-97387012 GATCATATAATCAATGTAGGAGG + Intergenic
1045373501 8:101548957-101548979 AATCAATTGATCAATGAAAATGG - Intronic
1046875532 8:119250769-119250791 CATCTTATGAGCAATGTACAAGG - Intergenic
1046974639 8:120260615-120260637 GATAAGATGATCAATCTAGAGGG + Intronic
1048541340 8:135344683-135344705 CATGAAATGCTCAATGTGGTTGG + Intergenic
1048705234 8:137146432-137146454 CATCACATGATTAATGAGGAAGG + Intergenic
1048718935 8:137300019-137300041 CATTAAATGAGCAATCTAGAGGG + Intergenic
1049929609 9:443756-443778 AATAAAATGATGTATGTAGAGGG - Intronic
1051207653 9:14705020-14705042 CATCAAATGAACAAAATAAAGGG + Intergenic
1051450092 9:17187331-17187353 CATCAAATGAACCAGGTAGAAGG - Intronic
1056239945 9:84635144-84635166 CAACATAAGATCAATGTATATGG + Intergenic
1057541845 9:95981257-95981279 CATCAAATAATTACTGTATATGG - Intronic
1058041562 9:100307928-100307950 CATTAAAAGTTCATTGTAGAAGG - Intronic
1061784434 9:133017938-133017960 CAACAGATTTTCAATGTAGATGG + Intergenic
1186275469 X:7933764-7933786 CTGCAAATGATCAATAGAGAAGG - Intergenic
1187363682 X:18649924-18649946 CATCAAATGCTCAAAGTGGAGGG - Intronic
1187441946 X:19328581-19328603 CATCAAATGGTCAAAGCACAAGG - Intergenic
1188663192 X:32786502-32786524 CATTAAATAATTAAAGTAGAAGG - Intronic
1188735680 X:33712071-33712093 CATCAACTGATGAATGGATAAGG + Intergenic
1189564157 X:42222520-42222542 AATCAATTGATGAATGGAGAAGG - Intergenic
1191744704 X:64473729-64473751 CATCAACTGATTAATGGATAAGG - Intergenic
1192275255 X:69623238-69623260 CATCTAAAAATCAATTTAGAGGG + Intronic
1193506681 X:82352318-82352340 CATAAAACGATCAATTTAGCAGG + Intergenic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1195598807 X:106723184-106723206 CAACAAGTGATAAATCTAGATGG - Intronic
1195690806 X:107623422-107623444 CAACAGATTTTCAATGTAGATGG - Intergenic
1197318370 X:124996690-124996712 CATCAAATAAGCAATTTCGAAGG + Intergenic
1198329267 X:135606522-135606544 TATCAAATGAGAAATGTAAAGGG + Intergenic
1198337275 X:135679056-135679078 TATCAAATGAGAAATGTAAAGGG - Intergenic
1199103460 X:143834895-143834917 CTACAAATGATGAATGTAAATGG + Intergenic
1199534500 X:148886892-148886914 CATGAAATGTTCAATGAACATGG - Intronic