ID: 1013585267

View in Genome Browser
Species Human (GRCh38)
Location 6:111572654-111572676
Sequence CTTGCTGTTCAGAGGTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013585264_1013585267 9 Left 1013585264 6:111572622-111572644 CCGCTGCATATGTGGTCAGCATT 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG 0: 1
1: 0
2: 1
3: 11
4: 188
1013585261_1013585267 24 Left 1013585261 6:111572607-111572629 CCTTCAGGCCAGGGGCCGCTGCA 0: 1
1: 0
2: 2
3: 23
4: 259
Right 1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG 0: 1
1: 0
2: 1
3: 11
4: 188
1013585263_1013585267 16 Left 1013585263 6:111572615-111572637 CCAGGGGCCGCTGCATATGTGGT 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG 0: 1
1: 0
2: 1
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013585267 Original CRISPR CTTGCTGTTCAGAGGTACTT GGG Intronic
900374095 1:2345455-2345477 CTTGTTGTTCAGAGCCACGTAGG - Intronic
900809957 1:4794391-4794413 CCTGCTCTTCAGAGCTAATTAGG - Intergenic
901407308 1:9057889-9057911 CTTGCTGTTTAGAGGGAATCCGG - Intronic
901822701 1:11840365-11840387 CTTGCTGGTCAGAGGTCCTGGGG + Exonic
902071181 1:13739819-13739841 TTTTCTGTTCAGAGGTGTTTGGG + Intronic
903674656 1:25056215-25056237 CTTGCTGTGCAGTGGGACTATGG + Intergenic
905345534 1:37308771-37308793 CCTGCTGGTCGGAGATACTTTGG + Intergenic
908640418 1:66216898-66216920 CTTGCTGTGCATAGGTAATGAGG - Intronic
911175136 1:94810964-94810986 CCTGCTCTTCAGAGGTACAAGGG + Intergenic
912595193 1:110868728-110868750 CTTTCTGTTCAGAAGCTCTTTGG - Intergenic
913255062 1:116945427-116945449 CTTGGTGTTCAGTGGAGCTTTGG + Intronic
917803445 1:178592121-178592143 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
921755893 1:218855469-218855491 CTTGCTGTCCAGAGGCACCTTGG + Intergenic
922443757 1:225678901-225678923 ATTGCTGTTCAGAGGTAATGGGG + Intergenic
923943380 1:238854767-238854789 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1064494220 10:15890793-15890815 CTTGCTGTTCACAGCTTCCTGGG - Intergenic
1067202843 10:44188811-44188833 CTTGTTTTTCAGTGGTCCTTTGG - Intergenic
1068888619 10:62124887-62124909 CTTGGCTTTCAGAGGAACTTGGG + Intergenic
1070167833 10:73911643-73911665 GGTGCTGATCAGAGGTCCTTGGG - Exonic
1071019394 10:81034300-81034322 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1071047642 10:81401630-81401652 CTTGCTGAACAAAGTTACTTTGG + Intergenic
1071387551 10:85137561-85137583 CTTCCTGTTCAGAGATACACAGG + Intergenic
1072193824 10:93097713-93097735 CTTGCTGATCACAGCTACTGTGG + Intergenic
1076716015 10:132364180-132364202 CTTGCTTTTCAGAGTAACTATGG - Intronic
1077331936 11:1987669-1987691 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1078621350 11:12911611-12911633 CACGATATTCAGAGGTACTTGGG + Intronic
1079596433 11:22254370-22254392 CTTTCTGTTCGGATATACTTAGG - Intronic
1079865836 11:25732645-25732667 CTTGCTGTGCAGAAGCTCTTGGG - Intergenic
1080152419 11:29068798-29068820 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1083238812 11:61370667-61370689 CTTGTTCTTCAGAGATGCTTTGG + Intergenic
1086071390 11:82803476-82803498 CTTTCTGTTCAGAGGTCCCTTGG - Intergenic
1086677799 11:89630565-89630587 CTTGCTGTTAATAGATACGTGGG + Intergenic
1086792493 11:91060080-91060102 CTTGCTGTACAGAAGCTCTTTGG - Intergenic
1088969516 11:114760613-114760635 CTTGCTGTTCACAGGCACTTTGG - Intergenic
1089865392 11:121627121-121627143 ATTGCAGTTCAGAGTGACTTTGG + Intronic
1089921385 11:122212825-122212847 CTTCCTGTTCAGAATTACCTGGG + Intergenic
1091215863 11:133901242-133901264 CTCTCTGTTCAGAGTTGCTTGGG - Intergenic
1202814917 11_KI270721v1_random:42845-42867 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1093491136 12:19705936-19705958 TTTGCTGTGCAGAAGTACTTTGG - Intronic
1094535745 12:31321664-31321686 TTTGCTGTTCAGAGGTTTCTGGG - Intronic
1095171088 12:39037356-39037378 CTTTCTCTTCAGAGCTTCTTTGG - Intergenic
1095702465 12:45204475-45204497 GTTGCTGTTCTGATGTCCTTGGG - Intergenic
1097579645 12:61439030-61439052 CTTGCTCTCCAGATCTACTTGGG - Intergenic
1110064439 13:71086271-71086293 TTTGCTGTGCAGAAGTTCTTTGG + Intergenic
1110886701 13:80646786-80646808 CTTTTTGTTCAGAGTTGCTTTGG + Intergenic
1112733369 13:102392556-102392578 CTTGCTGTTAAAAGCTACCTCGG + Intronic
1114706438 14:24731660-24731682 TTTGCTGTTCAGAAGCTCTTTGG - Intergenic
1116177655 14:41493353-41493375 CAAGCTGTTGATAGGTACTTTGG - Intergenic
1117659855 14:57992344-57992366 CTCACTGTTCAGAGGTAATAAGG - Intergenic
1119350887 14:73964478-73964500 CCTGGAGTTCAGAGGTATTTGGG + Exonic
1119545693 14:75469831-75469853 CTGGCTGTTCGGAGGTTCCTTGG - Exonic
1119865242 14:77967711-77967733 TTTGCTGTTCAATGGTATTTGGG + Intergenic
1120386099 14:83847819-83847841 CTGTTTGTTCAGAGGTACTATGG + Intergenic
1120486094 14:85114681-85114703 CTCGCTGTTCAGACCCACTTGGG + Intergenic
1120491671 14:85186098-85186120 CTTGCCTTTCAAAGTTACTTTGG + Intergenic
1120791942 14:88592248-88592270 CTTGCTGTTAACAGTTACTATGG + Intronic
1122653312 14:103239321-103239343 CTTGCTGTTAATAGATACGTGGG + Intergenic
1124946683 15:34274355-34274377 CTTGCTGTTGACAGTTTCTTGGG - Intronic
1126411302 15:48375612-48375634 GGTGCTGTTCAAAGGTGCTTGGG - Intergenic
1127354147 15:58182027-58182049 CTTGCCGTTCAGGAGTACATGGG - Intronic
1127655309 15:61049957-61049979 CCTGCAGTTAAGAAGTACTTGGG - Intronic
1130617842 15:85429376-85429398 CTTGCTGCACAGAGGTAGTCAGG - Intronic
1132236026 15:100222369-100222391 CTTTCTGTTCAGACGTGCTGTGG - Intronic
1133044685 16:3081186-3081208 CTTGCTGTTAATAAATACTTGGG - Intronic
1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG + Intergenic
1135583664 16:23650155-23650177 CTTTCTGTTCAGGATTACTTTGG + Intronic
1143310732 17:5986588-5986610 TTTGCTGTGCAGAAGTTCTTTGG - Intronic
1147765007 17:42828756-42828778 CTTGCTGTTAAGAGGCATCTGGG + Intronic
1148292617 17:46468474-46468496 CCTGCTGTATAGAAGTACTTTGG + Intergenic
1148314801 17:46686167-46686189 CCTGCTGTATAGAAGTACTTTGG + Intronic
1149037697 17:52154536-52154558 CTTGCTGATCTGAGCTGCTTTGG + Intronic
1150303165 17:64063087-64063109 CTTGCTGGTGACAGGTACTAGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1156157993 18:34326680-34326702 TTTGCTGTGCAGAGGCTCTTTGG - Intergenic
1157051404 18:44170206-44170228 CTTGCTGTACAGAGGCTGTTTGG - Intergenic
1161866722 19:6837812-6837834 CTTGCTCTTAAGAAGTATTTAGG - Intronic
1164438364 19:28251890-28251912 CATGCTGTTCAGATTAACTTGGG + Intergenic
1166737879 19:45096977-45096999 CTTGCTGTTCCCAGGCCCTTGGG - Intronic
925457876 2:4032397-4032419 GTTGCTGTGCAGAAGTCCTTTGG + Intergenic
926517884 2:13872045-13872067 CTTTCTGATCATAAGTACTTTGG + Intergenic
927491866 2:23526245-23526267 CATGCAGTTCAGAGGAACGTGGG + Intronic
929377645 2:41309129-41309151 CTTGATGGTCAAAGGTGCTTTGG - Intergenic
930898080 2:56469270-56469292 CTTGCTGTGCAGAAGCACTTTGG - Intergenic
933857303 2:86428493-86428515 CTTGCTGTTCTCAGATGCTTGGG - Intergenic
935367259 2:102307799-102307821 CTTCCCTTGCAGAGGTACTTGGG - Intergenic
936650899 2:114424746-114424768 CTTACTGTTGATAGGTACATAGG + Intergenic
938819914 2:134947010-134947032 GTTGCTGTTCAGAATTACTGGGG - Intronic
941232974 2:162934232-162934254 CTCTCTGTCCAGAGGAACTTTGG + Intergenic
942371963 2:175294856-175294878 CTTGCTGTACAGTGGTATTGGGG + Intergenic
942775613 2:179578263-179578285 CCTGCTCTTAAGAGGTAGTTGGG + Intronic
943066194 2:183089299-183089321 CTGCCTGTCCAGAGGTATTTTGG - Intronic
947957229 2:234202533-234202555 CTTGCTGAACAGCAGTACTTGGG - Intergenic
1169081249 20:2798876-2798898 CATGCTGTTCTGAGGTCCCTTGG + Exonic
1169112496 20:3043174-3043196 CAGGCTGTTCAGAGGTACAGGGG - Intergenic
1169646355 20:7814138-7814160 CTTTCTGTTGATAGGCACTTAGG + Intergenic
1170089497 20:12575153-12575175 CTTGCTATGCAGCGTTACTTCGG - Intergenic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1173931778 20:46826895-46826917 GTTACTCTTCAGAGTTACTTGGG - Intergenic
1176018624 20:62951744-62951766 CTTTCTGTTCAGAGGGCCCTGGG + Intergenic
1177480979 21:21688178-21688200 GTTGCTGTTCAGTGTTATTTTGG + Intergenic
1179067362 21:38038426-38038448 CTTCCTGTTCCAAGATACTTGGG + Intronic
1179174577 21:38998806-38998828 TTTGCTGTGCAGAGGCTCTTAGG + Intergenic
1185031772 22:48447489-48447511 GTTCCTGTTCAGTGGTACTGAGG - Intergenic
951266986 3:20578800-20578822 CTTTGAGTTCAGATGTACTTTGG - Intergenic
954507012 3:51086084-51086106 CTTGCTGTTAAGAAATACATGGG - Intronic
955131163 3:56170511-56170533 CTTGCTTTTTAGAGGAACTAAGG - Intronic
956885501 3:73555078-73555100 TTTGCTTTTCAGAGGCAATTAGG + Intronic
956943992 3:74197938-74197960 CTTGCTGTTAATAGATACGTGGG + Intergenic
957491177 3:80929209-80929231 CTTGCTGTTAATAGATACGTGGG + Intergenic
958467716 3:94478268-94478290 CTTGGTCTTGAGAGGTTCTTTGG + Intergenic
960473283 3:118093753-118093775 CTTGCCTTTCAGACGTACATGGG + Intergenic
960550597 3:118972073-118972095 CTTTCTGTTCTTAGGAACTTGGG - Intronic
961119768 3:124363982-124364004 CTTGCTGTTGAGAGGTCACTGGG - Intronic
961755321 3:129123484-129123506 ATTGCTTTTCAGTGGCACTTTGG - Intronic
964260369 3:154828615-154828637 CTTGTTTTTCAGATTTACTTTGG + Intergenic
964311261 3:155395729-155395751 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
964312788 3:155412201-155412223 CTTACTGTTCAGGGGTCCTGTGG - Intronic
967668892 3:192208023-192208045 CTTGCTATTTAGAGGAACTCTGG - Intronic
968251702 3:197222545-197222567 TTTGCTGTTAAGAGATAATTGGG - Intronic
968821379 4:2854595-2854617 CTTCCTGTTGAGCTGTACTTAGG + Intronic
970391945 4:15620979-15621001 CTTGCTGTTAATAAATACTTTGG + Intronic
975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG + Intronic
976101628 4:81570221-81570243 CTTGCTGTCAATAGATACTTTGG - Intronic
976511870 4:85920544-85920566 TTTGCTGTGCAGAAGTTCTTTGG - Intronic
979563377 4:122125369-122125391 CTTGCTTTTCAGAGGTCTTGAGG + Intergenic
979639680 4:122999285-122999307 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
980109258 4:128619557-128619579 CTTTTTGTTCAGGGTTACTTTGG - Intergenic
980315058 4:131188160-131188182 TTTGCTGTGCAGAAGTACTTTGG + Intergenic
981133459 4:141184479-141184501 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
981439475 4:144766961-144766983 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
982059746 4:151592739-151592761 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
982685694 4:158486197-158486219 CTTGGAGTTCAGTGGTGCTTTGG - Intronic
984664651 4:182412337-182412359 CTTGCTGTTTGGTGGTATTTTGG - Intronic
985022501 4:185706904-185706926 CTTCCTGTTCAGGGGCATTTGGG + Intronic
985970116 5:3369642-3369664 CTTGCTGTGCAGAAGTCCTTTGG + Intergenic
986880051 5:12158657-12158679 TTTGCTGTGCAGAAGTGCTTTGG - Intergenic
990209166 5:53463773-53463795 CTTATTGTTCAGAGATGCTTGGG + Intergenic
994860526 5:105186859-105186881 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
995315039 5:110760153-110760175 GTTGCTGTCCAGAGGAACTGGGG - Intronic
996222635 5:120952385-120952407 CTTTTTGTTCAGAATTACTTTGG + Intergenic
997041681 5:130263908-130263930 TTTGCTGTACAGAAGTTCTTTGG + Intergenic
1000095366 5:157966806-157966828 CTGGCTGCTCAGAGGGATTTGGG - Intergenic
1000115635 5:158150974-158150996 CTTGCTGTTGAGATGGACTCAGG - Intergenic
1000628055 5:163562177-163562199 CTTGCTTTCCAGAGGTACTAGGG + Intergenic
1001256318 5:170186111-170186133 ATTTCTGCTCAGAAGTACTTGGG + Intergenic
1001942411 5:175750169-175750191 CTCCCTGTCCAGAGGAACTTGGG + Intergenic
1003796941 6:9615294-9615316 CTTGCTGTTCACAGGTGTTTCGG - Intronic
1006491311 6:34391116-34391138 GTTGCTGTCCAGAGGTATTTAGG - Intronic
1007824043 6:44585139-44585161 TTTGCTGTTCAGAAGCTCTTTGG + Intergenic
1008528704 6:52434287-52434309 CTTGCTTCACAGGGGTACTTGGG - Intronic
1008799705 6:55351484-55351506 CTTGCTGTGAAGAGCTTCTTTGG - Exonic
1012585847 6:100921571-100921593 TTTGCTGTGCAGAAGTGCTTAGG - Intergenic
1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG + Intronic
1014968335 6:127783403-127783425 TTTGCTGTGCAGAAGTTCTTTGG - Intronic
1015227021 6:130869554-130869576 TTTGTTGTTCAGAGGTAAATGGG - Exonic
1020552694 7:9626468-9626490 TTTGATGTTCAGAGGTATGTGGG + Intergenic
1022386049 7:29900414-29900436 CTTCCTGTCCACAGGTGCTTGGG - Intronic
1023907977 7:44535736-44535758 TTTGCTGTTCTGAGGTGCTGTGG + Intronic
1024860013 7:53827865-53827887 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1025122512 7:56317283-56317305 CTTGCTGTTCATAAATACGTGGG + Intergenic
1026441314 7:70446785-70446807 CTTCCTGCTCAGAGGTGCTGCGG + Intronic
1026508499 7:71007302-71007324 AGTGGTGTTCAGAGGTACTCAGG + Intergenic
1027521016 7:79207728-79207750 CTTTCTGCTCAGAGTTGCTTTGG - Intronic
1028380210 7:90191868-90191890 CATGCTGTCCAGAGTTACCTGGG + Intronic
1031188994 7:118522242-118522264 CTTTTTGTTCAGTGTTACTTTGG - Intergenic
1037152731 8:15657008-15657030 CTCACTGTTCAGAGCCACTTGGG - Intronic
1038645099 8:29354396-29354418 CTTGATGGGCAGAGGTACGTAGG - Intergenic
1039847527 8:41336310-41336332 CTTGCTGTTCTGTTGTTCTTAGG - Intergenic
1040788980 8:51202349-51202371 TTTGCTGTACAGAAGTTCTTTGG + Intergenic
1040823345 8:51590066-51590088 CTTGCTGCTCAGAGCCACATTGG + Intronic
1042002667 8:64143802-64143824 CTATCTGTTCATAGGCACTTAGG - Intergenic
1044389738 8:91635939-91635961 CTTGCTGTTAAGAACTACTATGG - Intergenic
1045817787 8:106297012-106297034 ACTGCTGTTTAGAGGCACTTAGG + Intronic
1045994113 8:108342880-108342902 CTTGCTTTACAGGGGTCCTTGGG + Intronic
1046018213 8:108631694-108631716 TTTGCTGTACAGAGGCTCTTAGG + Intronic
1048547100 8:135397399-135397421 CTTGCTGCTGAGAGGTACCCAGG - Intergenic
1055776346 9:79770516-79770538 CTTTCTAGTCAGAGCTACTTTGG - Intergenic
1057285589 9:93751206-93751228 CTTGCTGTTAATAAATACTTGGG - Intergenic
1062485666 9:136774037-136774059 CTTGCTGTTCTGACTTCCTTAGG - Intergenic
1203761538 EBV:14889-14911 CTTGCTTTTCACAGGAACCTGGG + Intergenic
1203762467 EBV:17961-17983 CTTGCTTTTCACAGGAACCTGGG + Intergenic
1203763396 EBV:21033-21055 CTTGCTTTTCACAGGAACCTGGG + Intergenic
1203764325 EBV:24105-24127 CTTGCTTTTCACAGGAACCTGGG + Intergenic
1203765254 EBV:27177-27199 CTTGCTTTTCACAGGAACCTGGG + Intergenic
1203766183 EBV:30249-30271 CTTGCTTTTCACAGGAACCTGGG + Intergenic
1203767112 EBV:33321-33343 CTTGCTTTTCACAGGAACCTGGG + Intergenic
1203638555 Un_KI270750v1:136618-136640 CTTGCTGTTCAGCGTGAGTTGGG + Intergenic
1185544165 X:928701-928723 CTGGCTGCTCAGAGGAACTGTGG + Intergenic
1188799105 X:34504849-34504871 TTTGCTGTGCAGAAGTTCTTTGG + Intergenic
1189405871 X:40721956-40721978 CTAGATATTCAAAGGTACTTAGG - Intronic
1189610158 X:42723758-42723780 CTTGCTATTCTGAGGTAGATTGG - Intergenic
1193584615 X:83305745-83305767 CTTCCAGTTCAGACTTACTTTGG + Intergenic
1193663017 X:84280161-84280183 TTTGCTGTGCAGAAGTTCTTAGG + Intergenic
1194031260 X:88818764-88818786 TTTGCTGTGCAGATGTTCTTTGG + Intergenic
1194846740 X:98818535-98818557 TTTGCTGTGCAGAAGCACTTTGG + Intergenic
1194984328 X:100473815-100473837 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1195769450 X:108334328-108334350 CTTGATGTTCAGAAGTAAATAGG - Intronic
1196685650 X:118508228-118508250 CTGGCTCTGCAGAGGTACCTGGG + Intronic
1197211722 X:123833659-123833681 ACTGCTGTTCTGAGCTACTTAGG + Intergenic