ID: 1013585440

View in Genome Browser
Species Human (GRCh38)
Location 6:111574670-111574692
Sequence GGTCCCTGCCCAATACCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013585436_1013585440 19 Left 1013585436 6:111574628-111574650 CCTCATTCTTGATGGCTGCTGCT 0: 1
1: 0
2: 4
3: 49
4: 513
Right 1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG 0: 1
1: 0
2: 0
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013585440 Original CRISPR GGTCCCTGCCCAATACCACA TGG Intronic
901129102 1:6951043-6951065 ACTCCCAGCCCAAAACCACAAGG - Intronic
901661975 1:10804330-10804352 GGTCCCTGCCACGTGCCACATGG + Intergenic
901978096 1:13011403-13011425 GGTTCCTGCCCAACAACACCAGG + Intronic
902003990 1:13217535-13217557 GGTTCCTGCCCAACAACACCAGG - Intergenic
902023213 1:13363279-13363301 GGTTCCTGCCCAACAACACCAGG - Intergenic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903601836 1:24547591-24547613 GGTCTATGACCAATACCATATGG - Intergenic
903672662 1:25045867-25045889 GCCCCCTGCCCACGACCACAAGG + Intergenic
903832207 1:26182223-26182245 GCCCCCTGCCCAGAACCACAGGG - Intronic
906123534 1:43411550-43411572 GGTTCCTGCCCAATCTCAAAGGG - Intronic
906292499 1:44628455-44628477 GATCCCATCCCAATACCACTTGG + Intronic
906378292 1:45314759-45314781 TGTCCCTGCCAAATACTATACGG - Intergenic
911866819 1:103037704-103037726 GGTGACTGCACAATTCCACAAGG + Intronic
913487559 1:119346959-119346981 CATCCCTGCCAAATACTACAAGG - Intergenic
915467353 1:156105362-156105384 AGTCCCTTCCCCATCCCACAGGG + Intronic
916192461 1:162192576-162192598 TGGCCTTGCCCAAAACCACATGG - Intronic
921582964 1:216916233-216916255 GGTCCCTGGCTGATAACACAGGG - Intronic
924012113 1:239676679-239676701 GGAGCTTGCCCAATACCACAGGG - Intronic
1065871336 10:29958858-29958880 GGCCCCTTTCCAACACCACAAGG - Intergenic
1072085811 10:92077988-92078010 GGTCCTTTTCCAATATCACATGG + Intronic
1076443380 10:130495658-130495680 GGTCCCTGCCCAGTCCCCCATGG + Intergenic
1077083942 11:738216-738238 GGGCCCTGCCCCACACCCCAGGG - Intergenic
1077169030 11:1158239-1158261 GATCCCTTCCCAACCCCACAAGG - Intronic
1080275120 11:30495019-30495041 GGTCCTGGACCAATACCCCATGG + Intronic
1081687824 11:45054988-45055010 GGTCCCTGCCCTGATCCACAGGG + Intergenic
1083167155 11:60897619-60897641 GTAACCTGCCCAATGCCACAGGG + Intronic
1084968686 11:72757714-72757736 GGATCCTTCCCTATACCACAGGG - Intronic
1086262478 11:84957160-84957182 AGTACCTGCCCAAGATCACATGG + Intronic
1089490103 11:118877622-118877644 GCTCCCTCCACAAGACCACACGG - Intergenic
1092124461 12:6065690-6065712 GGAGGCTGCCCAATAGCACAGGG + Intronic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1093784247 12:23174354-23174376 GGTCCCTCCCCCATAACACGTGG + Intergenic
1096524277 12:52201263-52201285 GACCCCTGCCCAAGTCCACACGG + Intergenic
1097151608 12:56983478-56983500 TGTCCCAGGCCAATACCAGAGGG + Intergenic
1099766730 12:86997256-86997278 TGTCCCTGCCAAATACTATAAGG + Intergenic
1101515096 12:105427533-105427555 CTTCCCTGCCCAGTACCACATGG + Intergenic
1102788070 12:115620310-115620332 GTTGCCTGCCCAAGACCACAGGG + Intergenic
1106565278 13:30879327-30879349 GTTCCTTGCCAAATACAACAAGG - Intergenic
1109430574 13:62229072-62229094 GATACCTGGCCAATACGACAAGG - Intergenic
1111364482 13:87223805-87223827 GGTTCCTGCCCAAGCTCACAGGG - Intergenic
1113009671 13:105749372-105749394 TTTCCCTGCCCAATACAATAGGG - Intergenic
1116870352 14:50064055-50064077 GGTCCCTGCACAAGGCCACAGGG + Intergenic
1117187729 14:53258659-53258681 TATCCCTGCCAAATACCATAAGG - Intergenic
1122890000 14:104727808-104727830 GCTCCCTGCCGAGGACCACAGGG + Intronic
1122931446 14:104934490-104934512 GGTTCCTGACCAAGACCACAGGG + Exonic
1123045075 14:105508220-105508242 TGTTCCTCACCAATACCACATGG + Intergenic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1130231730 15:82102393-82102415 AGCCCCAGCCCAATGCCACAAGG - Intergenic
1132609549 16:808441-808463 GTTACCTGCCCAACAACACAGGG + Intronic
1136984461 16:35085655-35085677 GGTTCCTGCCCAAGCCCACCTGG + Intergenic
1138416548 16:56874883-56874905 AGGCCCTGCCCAACACCACCTGG - Intronic
1139429159 16:66901850-66901872 GATCCATGCCCAGAACCACAAGG - Intergenic
1139489908 16:67280470-67280492 GGTCGCTGTCCAATGCCCCAGGG - Exonic
1140477841 16:75247875-75247897 GTTCTCTGCCCAAGACCCCAGGG + Intronic
1140528515 16:75644372-75644394 GGTCCCTGCGCAAAACCTCCTGG - Exonic
1142119928 16:88382254-88382276 GGAACCTGCCCAAGGCCACACGG - Intergenic
1144782694 17:17815891-17815913 GGTCCGTGCTCAGTACCCCATGG - Exonic
1144993382 17:19249514-19249536 GGTCCCTTACCTTTACCACATGG - Intronic
1148089403 17:45013788-45013810 GGTCCCTCCTCACTATCACAGGG + Intergenic
1148334411 17:46832047-46832069 GGGCACTGCCCAAAACCACGCGG - Intronic
1149472431 17:56928394-56928416 TATCCCTGCCAAATACTACAAGG + Intergenic
1150281784 17:63933118-63933140 GTTCCCTGCCCAAGACCCCCTGG - Intergenic
1150350174 17:64438214-64438236 CGTACAGGCCCAATACCACATGG + Intergenic
1151259992 17:72908690-72908712 GGTGCATGCCAAATACCAGAGGG + Intronic
1152190090 17:78883057-78883079 GGTTCCTGCCCAGCACCACAGGG - Intronic
1152561678 17:81081846-81081868 GGGCCCTGCCCCACTCCACAGGG + Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1156962576 18:43050711-43050733 GGTTCCTGCCCAATACCTGAGGG + Intronic
1158106359 18:53889009-53889031 GGTCTCTGCCTCAGACCACAGGG - Intergenic
1161322010 19:3645705-3645727 GGTGCCTGCTCAAGGCCACATGG + Intronic
1161668140 19:5589468-5589490 GGACCCTGCCCAGCGCCACAGGG - Intronic
1162938209 19:13992532-13992554 GGATCCTGCCCAAAACAACAGGG + Intronic
1166891710 19:45998146-45998168 CAACCCTGCCCCATACCACAGGG - Intronic
1168104555 19:54158704-54158726 GGTCCCTGGCCTAAACCAAAGGG + Intronic
926677129 2:15635043-15635065 GGTTCCTGGCCAATTCCAAATGG + Intergenic
927006147 2:18851444-18851466 CGTCCCTGCCAATTACCAGAAGG + Intergenic
928170091 2:28998015-28998037 GGTCCCTGCCCAAAAAACCAAGG - Intronic
928932458 2:36637886-36637908 GCACCCTGGCCATTACCACATGG - Intronic
932412695 2:71556546-71556568 GGTGGCTCCCCAAAACCACATGG - Intronic
935328028 2:101955459-101955481 GGGCTCTGTCCAACACCACAGGG - Intergenic
944035574 2:195290755-195290777 GGACCATTCCCACTACCACAAGG + Intergenic
944839026 2:203607790-203607812 GGACCCTACCCAAGACCACGTGG - Intergenic
945557237 2:211294043-211294065 GTTCTCTACCCAATACCCCAAGG + Intergenic
948047020 2:234952398-234952420 GGTCCCTGCCCACCAGCACCAGG - Intronic
1168870215 20:1121148-1121170 GGTCCTTGACCAATTCCCCAAGG + Intronic
1168970594 20:1928154-1928176 GGTCTCTGCCCCAGTCCACATGG - Intronic
1170418617 20:16170533-16170555 GGCACCTGGCCAATAACACACGG - Intergenic
1173523608 20:43716318-43716340 GTTCCCTCCCCAAGGCCACAGGG + Exonic
1174246259 20:49183605-49183627 TCTCTCTCCCCAATACCACAAGG - Intronic
1175402052 20:58706604-58706626 GGTCCCTGGCCAGCACCTCAGGG - Intronic
1178327426 21:31657211-31657233 AGGCCCTGCCCAGTGCCACAAGG - Intergenic
1178592292 21:33921565-33921587 GGTACTTGCCCAAGGCCACAGGG + Intergenic
1178690184 21:34744010-34744032 GCAACCTGCCCAAAACCACAGGG - Intergenic
1179408190 21:41142556-41142578 GGACCTTGCCCAAGGCCACACGG + Intergenic
1179579172 21:42329278-42329300 GTTGCCTGGCCAATACCCCAGGG + Intergenic
1183112818 22:35664179-35664201 TATCCCTGCCAAATACCAGAAGG + Exonic
953213747 3:40898550-40898572 CCTCCCTTCCCAAGACCACATGG - Intergenic
954184750 3:48908372-48908394 GTTCCCTGCCCAAGGTCACATGG + Intergenic
957438467 3:80210975-80210997 ATTCCCTTCCCAATACCACATGG + Intergenic
960419439 3:117425875-117425897 GGTGACTGCCCAATCCCAGAAGG + Intergenic
961017697 3:123480443-123480465 TGCCCCTGCCCAGGACCACAGGG - Intergenic
962317513 3:134367961-134367983 GGTCCCTGCCTAACACTAGAGGG - Intronic
966002850 3:174971531-174971553 GATTTCTGCCCAATACCAGAAGG - Intronic
969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG + Intronic
969839954 4:9873992-9874014 GGTGGCTGCCCACTTCCACAAGG + Intronic
971240874 4:24887697-24887719 GGTCCCTGCCAGAGATCACAGGG - Intronic
977949993 4:102959702-102959724 GGCCCCTGACCAACAGCACAGGG - Intronic
981292550 4:143092820-143092842 TATCCCTGCCAAATACTACAAGG + Intergenic
984865382 4:184276154-184276176 GGTACTTGCCCAAATCCACAGGG - Intergenic
985361465 4:189179833-189179855 GGGCCCTGCCCCACACCAGAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992733054 5:79691187-79691209 AGTCCCTGCCCACTACTTCAAGG - Intronic
993086780 5:83372963-83372985 AGTCCATGCTCAATAGCACAAGG + Intergenic
993129283 5:83875270-83875292 GGCCTCAGCCCAACACCACAAGG + Intergenic
996088812 5:119330549-119330571 GGACCCTGCACAATAGGACAGGG - Intronic
1004089343 6:12484547-12484569 TTTCCCTGTCCAATAACACATGG + Intergenic
1006947263 6:37793018-37793040 GAACCCTGCCCAATCCCAAAGGG + Intergenic
1007234435 6:40380050-40380072 GGTCCCTGCCTAAGATAACAAGG - Intergenic
1013281746 6:108644194-108644216 GAAACCTGCCCAAGACCACATGG - Intronic
1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG + Intronic
1014110457 6:117615069-117615091 TATCCCTGCCAAATACTACAAGG + Intergenic
1022394351 7:29972419-29972441 GGTGCTTGCCCAAAACCCCATGG - Intronic
1023912790 7:44567345-44567367 GGACCCTTCCCAATGCCACAGGG - Intronic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1029950974 7:104585206-104585228 GGTACCTGGCGACTACCACAAGG + Intronic
1032445160 7:131976007-131976029 GGACCCTGACCAATACAAGATGG - Intergenic
1042715048 8:71763421-71763443 GGTCCCTGCCCAATTTCTCCAGG - Intergenic
1047820537 8:128514966-128514988 GCTCCCTGCCCAGAAACACAAGG + Intergenic
1055058052 9:72041566-72041588 GGTCCTTGCCCAAGGTCACATGG + Intergenic
1058949383 9:109889523-109889545 GGTCCCTGCCCTATCCTCCAAGG + Intronic
1059423388 9:114206303-114206325 GGTTCCTGGCCAGTGCCACATGG + Intronic
1062516968 9:136941707-136941729 GGTCCCTGTCCAATGCCCCAAGG + Intronic
1062600911 9:137318262-137318284 GGTCCCTGCCCAGCCCCACAGGG + Intronic
1062631527 9:137465226-137465248 AGCCCCTGCCCAGTACCAGAGGG + Intronic
1190936481 X:55002889-55002911 TGTCCCTTCCCCATACCACATGG - Intronic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1196772843 X:119312288-119312310 TATCCCTGCCAAATACTACAAGG + Intergenic
1198040325 X:132844641-132844663 GGCCCCCTCCCAACACCACAGGG + Intronic
1201928025 Y:19311312-19311334 CTCCTCTGCCCAATACCACATGG + Intergenic