ID: 1013588708

View in Genome Browser
Species Human (GRCh38)
Location 6:111602414-111602436
Sequence ACGGAGTGAAGGAGAGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1273
Summary {0: 1, 1: 0, 2: 8, 3: 99, 4: 1165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013588701_1013588708 -5 Left 1013588701 6:111602396-111602418 CCTAATTCAGCCACAGCCACGGA 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG 0: 1
1: 0
2: 8
3: 99
4: 1165
1013588699_1013588708 -4 Left 1013588699 6:111602395-111602417 CCCTAATTCAGCCACAGCCACGG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG 0: 1
1: 0
2: 8
3: 99
4: 1165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013588708 Original CRISPR ACGGAGTGAAGGAGAGGAAG GGG Intronic
900315106 1:2052423-2052445 AAGGAGGGAGGAAGAGGAAGGGG - Intronic
900466430 1:2827769-2827791 AAGGAGAGAAGGAGAGAGAGGGG + Intergenic
900802675 1:4747122-4747144 AGGGAGAGAAGGAGAGGAAGAGG + Intronic
900918547 1:5656134-5656156 AAGGAGGGATGGAGAGAAAGAGG + Intergenic
901004388 1:6164841-6164863 AAGGAGAGAGGGTGAGGAAGGGG + Intronic
901128049 1:6943167-6943189 ACGGAGGGGAGGAGGGGAGGAGG - Intronic
901135070 1:6987806-6987828 AAGGAGTGATGGGGAAGAAGGGG - Intronic
901450059 1:9330632-9330654 AAGGAGGGGAGGAAAGGAAGAGG - Intronic
901519120 1:9769100-9769122 AAGGAGGGAAGGAGAGAGAGAGG + Intronic
902107057 1:14046708-14046730 ACTGAGTGCAGGTAAGGAAGAGG - Intergenic
902260698 1:15222749-15222771 AAGGAAGGAAGGAAAGGAAGGGG + Intergenic
902325902 1:15700575-15700597 TTGGAGTTAAGGAGAGGGAGAGG - Intronic
902490860 1:16779428-16779450 AGGGGGTGAGGGAGAGGAAGGGG + Intronic
902763493 1:18599524-18599546 AGGGAGAGAAGGAGAGGGAAGGG + Intergenic
903165343 1:21516320-21516342 AAGGAGTGGAGGAGGGGAAATGG - Intronic
903396266 1:23003922-23003944 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
903426274 1:23256770-23256792 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
903606744 1:24580397-24580419 ACGGAGGGAAGGGGTGGAGGGGG + Intronic
903638449 1:24837909-24837931 ATGGAGTAAAGGAGAAGCAGAGG - Intronic
903650503 1:24918982-24919004 AGGGAGTCAAGGAAAGGAAAAGG - Intronic
903989205 1:27253466-27253488 AAAGAGAGAAGAAGAGGAAGAGG - Intronic
904119880 1:28191029-28191051 AAAGGGTGAGGGAGAGGAAGAGG - Intronic
904348718 1:29891138-29891160 AAGGAGTGAAGGAGAGAGAGAGG + Intergenic
904393728 1:30204113-30204135 ACGGAGTGAGGGTGAGGACAGGG - Intergenic
905266929 1:36760721-36760743 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
905295454 1:36951709-36951731 AAGAAGAGAAGGTGAGGAAGAGG + Intronic
905309127 1:37037410-37037432 AGGGAGGGGAGGGGAGGAAGGGG - Intergenic
905362369 1:37429787-37429809 AGGGAGGGAGGGAGAGAAAGAGG - Intergenic
905460337 1:38118679-38118701 AAGGAGAGAAGGAAAGAAAGAGG - Intergenic
906141179 1:43534495-43534517 TGGGAGTGAAGGAGAGGAAGAGG + Intronic
906243205 1:44255235-44255257 AGGGAGTGAAGGAGTGAAGGAGG - Intronic
907045605 1:51298394-51298416 AAGGAGTGTAGGGGAGGAAATGG - Intronic
907802074 1:57778949-57778971 GTGGAGTGAAGGAGGGAAAGAGG - Intronic
907999973 1:59670223-59670245 CCTGGGTGAAGGAGAGGAAGAGG - Intronic
908341316 1:63182549-63182571 AGAGAGAGAGGGAGAGGAAGAGG + Intergenic
908782299 1:67701443-67701465 ACTGAGTGAAGGAAGGGAAAGGG + Intergenic
909085432 1:71165292-71165314 ATGAAGAGAGGGAGAGGAAGAGG - Intergenic
909431052 1:75588241-75588263 AAGGAGTGAAGGAGGGAAGGAGG + Intronic
909973406 1:82018213-82018235 GCGGAATGAAGGGGAGGAAGGGG - Intergenic
910563196 1:88614749-88614771 TCAGACTGAAGGAGATGAAGGGG - Intergenic
910615068 1:89188570-89188592 AAGGAGTTAAGGTGAGGAAAAGG - Exonic
910735038 1:90444352-90444374 AAGGAAGGAAGGAGAGAAAGAGG + Intergenic
911064669 1:93777513-93777535 AAGGAAAGAAGAAGAGGAAGAGG - Intronic
911809114 1:102251434-102251456 ATCGTGTGAAGGAGAGGAAAAGG - Intergenic
912067213 1:105758432-105758454 CAGGAATGAAGGAGTGGAAGTGG + Intergenic
912331225 1:108821844-108821866 ACAGAGAGAAGAAGAAGAAGAGG - Intronic
912751517 1:112292561-112292583 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
912937609 1:114017535-114017557 AAGGAAAGAAGAAGAGGAAGTGG - Intergenic
913153288 1:116067042-116067064 AGGGAGTGAGAGTGAGGAAGAGG + Exonic
913466533 1:119148790-119148812 AAGGAGGGAAGGAAAAGAAGAGG + Intergenic
913509540 1:119549398-119549420 ATGGACTGAAAGAGATGAAGAGG + Intergenic
913513393 1:119582580-119582602 ATGGACTGAAAGAGATGAAGAGG + Intergenic
913517021 1:119613527-119613549 ATGGACTGAAAGAGATGAAGAGG + Intergenic
914334754 1:146704264-146704286 AGGGAGAGAGGGAGAGAAAGGGG + Intergenic
914428810 1:147601035-147601057 CCAGAGGGAAGGAGAGGGAGGGG + Intronic
914683753 1:149959796-149959818 ACTGTGTGAAGGACAGGCAGGGG + Exonic
914786998 1:150842550-150842572 AAGGAGGGAGGGAGAGGAAATGG + Intronic
914799403 1:150949459-150949481 ACTGAGTGCAGGAGATGTAGGGG - Exonic
915343001 1:155186387-155186409 AGGGAGTGAAGGAGAGCAGAGGG - Intronic
915521872 1:156450477-156450499 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
915549249 1:156623264-156623286 AGGAAGAGAGGGAGAGGAAGGGG + Intronic
916373885 1:164130311-164130333 ACAGAGTGAAGGAGAAACAGTGG - Intergenic
916460963 1:165023790-165023812 AGGGAGAGAGAGAGAGGAAGGGG + Intergenic
916699949 1:167281924-167281946 ACTGAGTGAAGGAGATGAGCAGG - Intronic
916863985 1:168836765-168836787 ACGGTGCAAAGGAGAGGGAGAGG - Intergenic
917619384 1:176780446-176780468 AGGGAGGGAAGGAGAGGTGGAGG + Intronic
917696268 1:177527426-177527448 AGAGAGAGAAAGAGAGGAAGAGG + Intergenic
918048391 1:180954587-180954609 CCGGAGGGATGGGGAGGAAGTGG + Intergenic
918273341 1:182925006-182925028 AAGGAAGGAAGGGGAGGAAGGGG + Intronic
918321644 1:183370626-183370648 AAGGAATGAGGAAGAGGAAGAGG + Intronic
918358127 1:183724981-183725003 ACGGAGGGAAGAGGAGGAGGAGG + Intronic
918876152 1:190046330-190046352 AGGGAGTGAAGGAGGGGAGAGGG + Intergenic
919221134 1:194629914-194629936 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
919303957 1:195806181-195806203 GTGGTGTGAAGGAGAGGAACTGG + Intergenic
919348974 1:196424096-196424118 AGGGAATGAAGGAGAGAGAGAGG - Intronic
919788638 1:201275997-201276019 GGGGAGTGAATGAGAGGCAGGGG + Intergenic
920131080 1:203732299-203732321 ACTGAGGGAGGGGGAGGAAGAGG - Intronic
920258444 1:204672680-204672702 AGGGAGGGAAGGAGAGCAAGAGG - Intronic
920669403 1:207991622-207991644 TCCCACTGAAGGAGAGGAAGGGG + Intergenic
920730977 1:208484117-208484139 ATGGAGTGAAGGTAGGGAAGGGG + Intergenic
920907778 1:210188069-210188091 ACGGAGTGAGGGTGAGGACCGGG - Intergenic
920948784 1:210553781-210553803 AGGGAGAGAGGGAGAGGAGGAGG - Intronic
921191096 1:212709287-212709309 AGACAGGGAAGGAGAGGAAGAGG - Intergenic
921759462 1:218896266-218896288 ACAGAAGGAAGGAGAGCAAGTGG + Intergenic
922089259 1:222380008-222380030 AGGAGGGGAAGGAGAGGAAGCGG - Intergenic
922110242 1:222548693-222548715 ACACAGTGAAGGAAAAGAAGGGG + Intergenic
922221081 1:223609133-223609155 ACGGAGGGAAGGAGACGCACAGG + Exonic
922455531 1:225770882-225770904 AGGGAGGGGAGGAGGGGAAGGGG + Intergenic
922598739 1:226833991-226834013 ACGGAGTGAGGGTGAGGATAGGG - Intergenic
922723236 1:227909669-227909691 AGGGAAGGAAGGAGGGGAAGAGG + Intergenic
922794484 1:228333321-228333343 AAGGTGAGAAGGAGAGGGAGTGG + Exonic
922845696 1:228682282-228682304 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
922993172 1:229932601-229932623 AGGGAGAGAGGGAGAGGGAGGGG + Intergenic
923127180 1:231042049-231042071 TGGGAGTAAGGGAGAGGAAGGGG + Intergenic
923294690 1:232582284-232582306 AGGGAAGGAAGGAGAGGATGGGG - Intergenic
923529585 1:234803108-234803130 AGGGGGTGAGGGAGAGGAAGGGG - Intergenic
923988093 1:239403954-239403976 AGGGAGGGAGGGAGAGGGAGGGG + Intronic
924127865 1:240874404-240874426 CTGGAGTGTAGGAGAGGAAAGGG + Intronic
924194660 1:241593118-241593140 ACTAAGTGAAGGACAGGAAAGGG + Exonic
924260797 1:242228703-242228725 AAGGAGAGAGAGAGAGGAAGAGG + Intronic
924452010 1:244187055-244187077 TCGGAGAGAAGGAGAGGGACTGG - Intergenic
924593553 1:245426184-245426206 AGGGAGGGAGAGAGAGGAAGGGG - Intronic
924665136 1:246063606-246063628 AGGAAGGGAAGGAGAGGGAGGGG - Intronic
1062922825 10:1292969-1292991 AGGGAGGGAAGGAGAGAGAGAGG + Intronic
1063577581 10:7275486-7275508 GAAGAGGGAAGGAGAGGAAGAGG + Intronic
1063866135 10:10367325-10367347 TGGGAGTGAAGGTGGGGAAGCGG - Intergenic
1064596840 10:16953887-16953909 AGGAAGGGGAGGAGAGGAAGGGG + Intronic
1064600754 10:16990058-16990080 AGTGAGTGAAGGAAAGGAGGAGG - Intronic
1064709453 10:18108989-18109011 ACAGAGTCAAGGAAAGGAAGAGG - Intergenic
1065177647 10:23095309-23095331 AAGGGGAAAAGGAGAGGAAGAGG + Intergenic
1065484810 10:26227511-26227533 AAGGAGGGAAGAAGAGAAAGGGG - Intronic
1065725187 10:28662124-28662146 GAGAAGGGAAGGAGAGGAAGGGG - Intergenic
1065743776 10:28820145-28820167 ATGTAGAGAATGAGAGGAAGTGG + Intergenic
1066045678 10:31593745-31593767 AGGGAGGGAAGGAGAGGAAGAGG + Intergenic
1066437591 10:35408223-35408245 ACGGAGTGAGGGTGAGGACAGGG + Intronic
1067430336 10:46238743-46238765 TGGGAGAAAAGGAGAGGAAGAGG - Intergenic
1068120590 10:52779338-52779360 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1068120598 10:52779358-52779380 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1068120606 10:52779378-52779400 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1068120614 10:52779398-52779420 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1068558160 10:58481868-58481890 GGGAAGTGAAGGTGAGGAAGGGG - Intergenic
1069060961 10:63894119-63894141 AGGGAGGGTAGGAGAGGAGGAGG - Intergenic
1069094222 10:64239023-64239045 ACGCATTGAAAGAGAGGAGGTGG + Intergenic
1069157681 10:65051718-65051740 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1069515354 10:69072829-69072851 AATGAATGAAGGAAAGGAAGGGG + Intergenic
1069657161 10:70098380-70098402 AGGGAGGGAAGGAGGGGGAGGGG + Intronic
1070274356 10:74990995-74991017 ACGGAGTCTAGGAAAGGACGAGG - Intronic
1070574892 10:77670448-77670470 AGGGAGGGGAAGAGAGGAAGGGG + Intergenic
1070574941 10:77670651-77670673 ACGGAGGGGAAGAGAGGAAGGGG + Intergenic
1070647121 10:78209828-78209850 AGGTAGAGAAGGAGAGGAAAGGG + Intergenic
1070783802 10:79151747-79151769 ATGGAGGGAGGGAGAGGCAGTGG - Intronic
1071543868 10:86512752-86512774 AGGGAGTAAAGGATGGGAAGTGG + Intronic
1071554894 10:86594368-86594390 AGGGAAGGAAGGAGAGGGAGGGG + Intergenic
1071810330 10:89173016-89173038 ACAGAGGAAAGGAGAGGAAAGGG + Intergenic
1071997149 10:91160730-91160752 AGGGAGTGACGGCGAAGAAGAGG + Intergenic
1072606174 10:96984587-96984609 AAGGAATGAAGGGAAGGAAGGGG + Exonic
1072732024 10:97852687-97852709 AAGGAGAGAGGGAGAGGAAGGGG + Intronic
1072750424 10:97974918-97974940 AGGGAGAGACGGAGGGGAAGGGG + Intronic
1073253963 10:102139234-102139256 GCGCAGTGATGGAGAAGAAGAGG + Exonic
1073592142 10:104767659-104767681 AGGGAGTGGAGAAGGGGAAGGGG - Intronic
1074278179 10:112024651-112024673 AGGGCCTGAAGGAGATGAAGAGG + Intergenic
1074557993 10:114509505-114509527 TGGGAGGGAGGGAGAGGAAGAGG - Intronic
1074614748 10:115056400-115056422 ACAAGGTGGAGGAGAGGAAGTGG - Intergenic
1074874412 10:117602897-117602919 TGGGAGGGATGGAGAGGAAGAGG + Intergenic
1074886637 10:117699224-117699246 AGGGAGTGATGGAGAGGAGTGGG + Intergenic
1075013155 10:118891909-118891931 AGGGAGGGAAAGAGAGCAAGAGG + Intergenic
1075192512 10:120323379-120323401 ACAGAAAGAAGGAGAGGAAGGGG - Intergenic
1075442891 10:122493833-122493855 AAGGAGGGGAGGAGGGGAAGGGG - Intronic
1075670492 10:124260996-124261018 TTGGAGTGAAGGAGGGGAGGAGG - Intergenic
1075679750 10:124323583-124323605 GAGGAGGGAAGGAGAGAAAGGGG + Intergenic
1076007978 10:126963564-126963586 AGGGAGGGAAGGAGAGGGAGAGG - Intronic
1076527415 10:131120824-131120846 AAGGAGTGAAGGAGCAGGAGGGG - Intronic
1076948508 10:133666781-133666803 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076951466 10:133676689-133676711 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076952456 10:133679999-133680021 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076955412 10:133742960-133742982 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076956402 10:133746270-133746292 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076957390 10:133749579-133749601 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1076959363 10:133756188-133756210 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1077535228 11:3120776-3120798 AGGGAGTGAGGGTGAGGAAGGGG - Intronic
1078829469 11:14965732-14965754 ACAGACTGAAGGAGAGAAGGGGG + Intronic
1079222238 11:18573369-18573391 AAGGAGGAAGGGAGAGGAAGAGG - Intronic
1079242161 11:18728821-18728843 GCTGACTGAAGGGGAGGAAGCGG + Exonic
1079323807 11:19474586-19474608 ATGGAGTGAAGGAGTGGATGAGG + Intronic
1079410285 11:20181111-20181133 GAGGAGAGAAGAAGAGGAAGAGG - Intergenic
1079529477 11:21432996-21433018 AGGGAGGGAAGGATAGGCAGAGG - Intronic
1079580685 11:22060154-22060176 AGAGAGAGAAGGAGAGGGAGAGG + Intergenic
1079816218 11:25062159-25062181 AGGGAAAGAAGGAGAGGAGGAGG + Intronic
1079899443 11:26163465-26163487 ACATAGTGAAGGACAGGAAGAGG - Intergenic
1080061605 11:27962292-27962314 AGGGAGTGGAGGAGGGGAATGGG + Intergenic
1080135084 11:28844759-28844781 AAGGAGAGAAGGAGAGAAGGAGG - Intergenic
1080387280 11:31817633-31817655 ACTGAGGGAGGGATAGGAAGGGG - Intronic
1080556590 11:33422552-33422574 AGGGAGGGAGGGAGAGGAGGGGG - Intergenic
1080610481 11:33899825-33899847 ACTGAGAGTAGGAGAGGAAAAGG - Intergenic
1080675134 11:34419069-34419091 AGAGAGAGAGGGAGAGGAAGAGG + Intergenic
1080835607 11:35937603-35937625 AAAGAGTGAGGGAGAGGGAGAGG + Intergenic
1081098468 11:38970029-38970051 ATGGAGGGAAGCAGAGGTAGTGG + Intergenic
1082012698 11:47460988-47461010 AGGGAGTGAGGGAGAGGATGGGG + Intergenic
1082233922 11:49799225-49799247 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1083305967 11:61762193-61762215 ACGGAGAGGAGGGGAGGCAGGGG + Intronic
1084698550 11:70770884-70770906 AGGGAGGGAAGGAGAGAAGGAGG - Intronic
1084806028 11:71579472-71579494 AGGTGGTGCAGGAGAGGAAGAGG + Intergenic
1084920341 11:72464468-72464490 ACAGAGAGAGGGAGAGGGAGAGG - Intergenic
1085095329 11:73755780-73755802 AGGGAGAAAAGGAAAGGAAGGGG + Intronic
1085263881 11:75224916-75224938 ACGGGGTGAAGGGGAGGGATGGG - Intergenic
1085276478 11:75303402-75303424 ACTGTGTGAAGGATGGGAAGGGG - Intronic
1085409629 11:76283431-76283453 AGGGAGGGATGGAGAGGGAGTGG + Intergenic
1085804650 11:79624080-79624102 ATGTGGTGAAGGACAGGAAGTGG + Intergenic
1085806981 11:79645318-79645340 ACGGAGTGAGGGAAAGAAAGAGG + Intergenic
1085992246 11:81863313-81863335 AAGGAGAGAAAGAGAGAAAGAGG + Intergenic
1086071771 11:82807215-82807237 AAGAAGAGAAGAAGAGGAAGAGG + Intergenic
1086202790 11:84223894-84223916 AAGGAGTGGAAGAGAGGATGGGG - Intronic
1086580941 11:88397578-88397600 ACGGAGCAAAAGAGAGGGAGTGG - Intergenic
1086756940 11:90576629-90576651 GGGGAGAGAGGGAGAGGAAGAGG + Intergenic
1087192358 11:95268273-95268295 ACAGAGAGAAAGAGAGAAAGAGG - Intergenic
1087341622 11:96914424-96914446 AGGGAGGGAGGGAGAGGAAGGGG - Intergenic
1089029380 11:115308759-115308781 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1089196294 11:116695746-116695768 AAGGAAAGAAGGAGAGAAAGAGG - Intergenic
1089233876 11:117005991-117006013 AGGGAGGGAAGGGAAGGAAGGGG + Intronic
1089455061 11:118621304-118621326 AAGGAGAGGAGGAGGGGAAGAGG - Intronic
1089498420 11:118919219-118919241 ACGGGGAGGAGGAGAGGCAGAGG + Intronic
1089587466 11:119519636-119519658 AGAGAGTGAGGGAGGGGAAGAGG + Intergenic
1089944734 11:122457219-122457241 AGGGAGGGAAGGAGGGGGAGAGG + Intergenic
1090015714 11:123084770-123084792 ATGGTGTGAAGAAGAGGAAAGGG + Intronic
1090028054 11:123184529-123184551 AAAGAGGAAAGGAGAGGAAGAGG + Intronic
1090241906 11:125189813-125189835 AGGGAAGGAAGGAGAGGGAGGGG - Intronic
1090522693 11:127496062-127496084 ATGGACTGTAGGAGAGGAAACGG + Intergenic
1090640038 11:128722273-128722295 AGGGTATGGAGGAGAGGAAGGGG + Intronic
1091044610 11:132314552-132314574 ACTGATTGAAGGAAAGAAAGGGG + Exonic
1091286185 11:134409850-134409872 ATGGAGAGGAGGAGAGGAACGGG - Intronic
1091332937 11:134744713-134744735 AGGGAGTGAGAGAGAGAAAGAGG + Intergenic
1091485129 12:879361-879383 AAGGAGAGCAGGAGAGAAAGAGG - Intronic
1091831541 12:3554039-3554061 AGGGAGGGAAGAGGAGGAAGAGG - Intronic
1091917702 12:4281452-4281474 ACAGAGTGACTGAGAGGCAGAGG + Intronic
1091989821 12:4946392-4946414 AGGGAGTGAGAGAGAGGAAGAGG + Intergenic
1092090096 12:5797253-5797275 GAGGAATGATGGAGAGGAAGTGG + Intronic
1092314828 12:7399488-7399510 AGGGAGGGAAAGGGAGGAAGAGG - Intronic
1092597922 12:10027687-10027709 AGGGAGAGAAGGAGAGAGAGCGG - Intergenic
1092902968 12:13076896-13076918 AGGGAGTGCAGGAGTGGGAGAGG + Intronic
1092966381 12:13647640-13647662 GCGGAGAGGAGGAGAGGAAAGGG + Intronic
1093181752 12:15974901-15974923 AGGGAGGGAAGGAGAGAGAGAGG - Intronic
1093302002 12:17470362-17470384 ACGGAGTGAGGGTGAGGACAGGG - Intergenic
1093838601 12:23868044-23868066 AGGGAGAGAAGGAGGGAAAGAGG - Intronic
1094042577 12:26133294-26133316 GGGGAGTGAGGGAGATGAAGGGG - Intronic
1094083753 12:26566114-26566136 AAGGAGAGGAGGAGAGGGAGAGG + Intronic
1094277035 12:28689221-28689243 AGGGAGTGGAGGAGAGCAAGCGG + Intergenic
1094567510 12:31613032-31613054 ACGGAAGGAAGGAGAGAAAGAGG + Intergenic
1094599749 12:31898181-31898203 AGGGAAGGAGGGAGAGGAAGGGG + Intergenic
1094825372 12:34265465-34265487 ACAGAGAGAGGAAGAGGAAGAGG - Intergenic
1095085185 12:38052638-38052660 ATGGAGAGAGGAAGAGGAAGAGG + Intergenic
1095570877 12:43684285-43684307 AGGGGGAGAAGGAGAGGGAGAGG - Intergenic
1095774704 12:45999606-45999628 AAGGGGAGAGGGAGAGGAAGAGG - Intergenic
1095806939 12:46329899-46329921 ACTGAGAGAGGGAGAGGAAGAGG + Intergenic
1095959139 12:47822946-47822968 AAGGAAAGAAGGAGAGGAAAAGG - Intronic
1095999386 12:48116141-48116163 AGGGAGTGAGGGAGAGAGAGAGG - Intronic
1096788823 12:54032821-54032843 AGGGAGTGAGAGAGAGAAAGAGG - Intronic
1096951797 12:55480091-55480113 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1097138335 12:56878669-56878691 AGAGGGAGAAGGAGAGGAAGAGG - Intergenic
1097138345 12:56878705-56878727 AGAGGGAGAAGGAGAGGAAGAGG - Intergenic
1097168702 12:57099908-57099930 CCGGGATGAAGGAGAGGATGGGG + Intronic
1097790673 12:63812005-63812027 AGGAAGACAAGGAGAGGAAGAGG + Intergenic
1098123148 12:67264153-67264175 TTGGAATGTAGGAGAGGAAGTGG - Intergenic
1098285544 12:68903797-68903819 ACAGAGGGAAGGAGAGACAGAGG - Intronic
1098567964 12:71956600-71956622 AAGGAAGGAAGGAGAGAAAGAGG - Intronic
1098633304 12:72751134-72751156 AAGGAGAGAAGCAGACGAAGAGG - Intergenic
1098758129 12:74390379-74390401 AGGGTGTGATGGAGAGAAAGTGG + Intergenic
1099133220 12:78862866-78862888 ATTTAGTGAAGGAGAGGAGGAGG - Intergenic
1099251246 12:80257623-80257645 AGGGAGAAAAGGAGAGGAATAGG + Intronic
1099389295 12:82059391-82059413 AAGGGAAGAAGGAGAGGAAGAGG + Intergenic
1099488801 12:83261597-83261619 ACTCAGAGCAGGAGAGGAAGGGG + Intergenic
1099532498 12:83801473-83801495 AGGGAGAGAAGGAGAGGAAAAGG + Intergenic
1100215873 12:92447938-92447960 GAGGAGTGTAGGGGAGGAAGAGG - Intergenic
1100236740 12:92669225-92669247 AGGGAGTGAGAGAGAGGGAGGGG + Intergenic
1100255792 12:92881428-92881450 ACGGAGGGAAGGAAAGGAAAAGG + Intronic
1100274818 12:93062449-93062471 ACCTAGTGAAGGAGAGGAGGAGG - Intergenic
1100807414 12:98301020-98301042 AACAACTGAAGGAGAGGAAGTGG - Intergenic
1101015589 12:100497023-100497045 AGGGAGTGGAGGCGAGGGAGTGG + Intronic
1101136438 12:101748424-101748446 AAGGATTGAAGGAGGGGAATGGG - Intronic
1101210447 12:102530211-102530233 AAGCAGTGATGGAGAGGAGGAGG - Intergenic
1101673282 12:106896578-106896600 GAGGAGGGGAGGAGAGGAAGGGG + Intergenic
1101673291 12:106896598-106896620 GGGGAGGGGAGGAGAGGAAGGGG + Intergenic
1101797454 12:107988620-107988642 ACTGAATGAAGGAGAGGAGAGGG + Intergenic
1101913102 12:108875471-108875493 AGGGAGTGGAGGGGAGGAAAGGG - Intronic
1102517519 12:113459850-113459872 GAGGGGTGAAAGAGAGGAAGAGG - Intergenic
1102591166 12:113957886-113957908 AGGGAGTGAGGCCGAGGAAGAGG - Exonic
1102631939 12:114288593-114288615 ACACAGTGAAGGAGAGGCTGGGG + Intergenic
1102679857 12:114684050-114684072 ACAGAGGGAAAGAGAGGGAGGGG + Intronic
1102689868 12:114751890-114751912 AGGCAGTGAAGGAGAACAAGTGG - Intergenic
1102983727 12:117262460-117262482 AGGGAGGGAGGGAGAGAAAGGGG + Intronic
1103118347 12:118357684-118357706 TGGGGGTGAAGCAGAGGAAGTGG - Intronic
1103232601 12:119344420-119344442 ACGGGGTGATGAAGAGGCAGAGG - Intronic
1103541159 12:121667569-121667591 ACAGAGTGAGGAAGAGGAGGAGG - Intronic
1103605686 12:122084388-122084410 AGGGGAGGAAGGAGAGGAAGGGG + Intronic
1103755877 12:123206465-123206487 AAAGAGAGAAAGAGAGGAAGAGG + Intronic
1103895897 12:124272939-124272961 AGGGAGAGAAAGAGAGGTAGTGG - Intronic
1104232011 12:126894452-126894474 AAGGACTGAAGGAGAGTAATAGG + Intergenic
1104232502 12:126898699-126898721 TAGGAGAGAAAGAGAGGAAGGGG + Intergenic
1104301410 12:127568421-127568443 AGGGAGTGAGAGAGAGGGAGAGG + Intergenic
1104410255 12:128551747-128551769 ACCGAGGAAAGGAGATGAAGGGG - Intronic
1104762206 12:131304248-131304270 AGGAAGTGGAGGAGAGGAGGAGG + Intergenic
1104782800 12:131432617-131432639 ACTGAAGGAAGAAGAGGAAGAGG + Intergenic
1104817570 12:131656548-131656570 AGGAAGTGGAGGAGAGGAGGAGG - Intergenic
1106402833 13:29445949-29445971 AGGGACAGAGGGAGAGGAAGAGG - Intronic
1106951217 13:34885734-34885756 AGGGAGGGAAGGGAAGGAAGGGG + Intergenic
1107820022 13:44277483-44277505 AGGGAGGGAAGGGGAGGAAAGGG + Intergenic
1107842624 13:44474771-44474793 AAGGAGGGAGGGAGAGGAAAGGG + Intronic
1107917673 13:45168994-45169016 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1108048382 13:46404857-46404879 AGGGAGGGAAGGAGTGAAAGAGG + Intronic
1108276978 13:48820937-48820959 ACAGAGTGAGTGAGGGGAAGTGG + Intergenic
1108642563 13:52396128-52396150 AGGGACTTAAGGAGAGGAAGTGG + Intronic
1109552216 13:63917995-63918017 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1110550992 13:76811422-76811444 AGGGAGAGAAGGGGAGGGAGTGG - Intergenic
1110666152 13:78119451-78119473 AGGGAGAGAAGGAGGAGAAGAGG - Intergenic
1110682368 13:78330597-78330619 ACAGAATGAAGGAGAGAAAAGGG - Intergenic
1110816482 13:79865947-79865969 AAGGGGAGGAGGAGAGGAAGAGG + Intergenic
1111415322 13:87934218-87934240 AGGGAGTCAAAGAGAAGAAGAGG + Intergenic
1112059997 13:95729333-95729355 ATGGGGAGAAGGAGAGGGAGAGG - Intronic
1112060012 13:95729387-95729409 ATGGAGAGAGGGAGAGGGAGAGG - Intronic
1112109994 13:96285914-96285936 AGGGAGGGAAGGAGGGAAAGTGG - Intronic
1112311084 13:98318036-98318058 AAGGAAGGAAGGAGATGAAGAGG - Intronic
1112879368 13:104087090-104087112 AGGGAGCGAGAGAGAGGAAGGGG - Intergenic
1113049651 13:106196267-106196289 AAGGAGGGAAGGAGAGGGAGAGG + Intergenic
1114221444 14:20701303-20701325 ATGGAGTGAAGGCGAGGACAGGG - Intergenic
1114262438 14:21047720-21047742 ATGGAGTAAAGGAGCGGAAATGG + Intronic
1114265704 14:21071407-21071429 AGGGAGTGGAGGAGGGGCAGGGG + Intronic
1114311668 14:21473167-21473189 GGGGAGGGAAGGAGAGGAAAGGG + Intronic
1114348398 14:21822713-21822735 AGAGGGTGAAGGAGAGGGAGAGG - Intergenic
1115026790 14:28756113-28756135 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
1115106352 14:29766098-29766120 ACGAAGAGAAGGAGAAGGAGAGG + Intronic
1115356586 14:32454712-32454734 AAGGAGGGAAGGAGAGAAGGAGG - Intronic
1115356632 14:32454824-32454846 AGGGAGGGAAGGAGAGAAGGAGG - Intronic
1115356661 14:32454896-32454918 AAGGAGGGAAGGAGAGAAGGAGG - Intronic
1115630167 14:35236990-35237012 AAGGAGTGAAGGAGGGAAGGAGG - Intronic
1115892291 14:38044837-38044859 ACAGAGCGAGGGAGAGGCAGTGG + Intergenic
1116027737 14:39535535-39535557 ACGGAGAGAAGGTGGGGAAAGGG - Intergenic
1116111722 14:40593568-40593590 AAGGAGGGAAAGAGAGAAAGAGG - Intergenic
1116144538 14:41047316-41047338 AAGGAATGAAGGAAAGTAAGGGG + Intergenic
1116189910 14:41650918-41650940 AGGGAGGGAGGGAGAGGGAGAGG + Intronic
1116427331 14:44807007-44807029 AGGGAGGGAGGGAGGGGAAGGGG + Intergenic
1117522565 14:56565532-56565554 TCCCAGAGAAGGAGAGGAAGAGG + Intronic
1117717799 14:58598679-58598701 TCAGAGGAAAGGAGAGGAAGGGG + Intergenic
1117920667 14:60723164-60723186 AGGGGGTGGGGGAGAGGAAGGGG + Intronic
1118145847 14:63135744-63135766 AAGGAGAGAAGGAAAGGAGGGGG + Intergenic
1118158969 14:63269939-63269961 ACGGATTGGTGGAGGGGAAGTGG + Intronic
1118514339 14:66509014-66509036 GGGAAGGGAAGGAGAGGAAGGGG - Intronic
1118797060 14:69153156-69153178 TCGGGGGGAAGGAGAGGGAGGGG - Intergenic
1119019088 14:71091093-71091115 GCTGAGGGGAGGAGAGGAAGTGG + Intronic
1119024639 14:71142922-71142944 ACTGAGTGAAGGGGAAGGAGGGG - Intergenic
1119618622 14:76114929-76114951 AAGGAGGGAAGAAGAGGAAGAGG + Intergenic
1119700122 14:76749577-76749599 ATGGGGAGAAGGAGAGGGAGAGG - Intergenic
1119714658 14:76850428-76850450 AGAGAGTGAAGGAGGGGAGGGGG + Intronic
1119737825 14:76995233-76995255 AGGGGGTTAATGAGAGGAAGAGG + Intergenic
1119762038 14:77158397-77158419 AGGGAGTGAAGGAGTGAGAGAGG + Intronic
1119960491 14:78850145-78850167 ACAGAGAGAGAGAGAGGAAGAGG + Intronic
1120003910 14:79335058-79335080 ACCTAGTGAAGGACAGGAAAGGG - Intronic
1120142361 14:80942801-80942823 AGGGATGGAAGGAGAGAAAGGGG - Intronic
1120433981 14:84456701-84456723 AGGGAGTGAGGGAGGGAAAGTGG + Intergenic
1120610573 14:86636446-86636468 GTGGAGGGAAGGAGAGGGAGAGG + Intergenic
1120811712 14:88810582-88810604 GGGGAGGGAAGGAGAGGGAGAGG - Intergenic
1120834943 14:89030983-89031005 AAGGGGTGAAGCAAAGGAAGGGG + Intergenic
1120895412 14:89527043-89527065 AGGGAGGGGAGGAGAGGAGGAGG + Intronic
1121002926 14:90465014-90465036 AAGGAGGGAAGGAGAGGTGGAGG + Intergenic
1121172968 14:91869831-91869853 AGTGAGAGAAGGAGTGGAAGAGG + Intronic
1121342048 14:93111242-93111264 ACAGAGAGGAGGAGAGGAGGAGG + Intronic
1121697968 14:95928371-95928393 AGGGAGGGAGGGAGAGGGAGAGG - Intergenic
1121741828 14:96257978-96258000 AGGGAGGGAAGGAGAGAAGGAGG + Intronic
1121800141 14:96768470-96768492 AGGAAGGGAAGGAGAGCAAGGGG - Intergenic
1122253886 14:100462898-100462920 AAGGAGCGGGGGAGAGGAAGCGG - Intronic
1122363863 14:101183100-101183122 AGGGAGGGAAAGAGGGGAAGGGG - Intergenic
1122363873 14:101183123-101183145 AGGGAGGGAAAGAGGGGAAGGGG - Intergenic
1122373403 14:101242169-101242191 AAGGAGAGAAGGAGAGACAGAGG + Intergenic
1122624649 14:103078184-103078206 AAGGAGGGAAGCAGAGGAAGGGG + Intergenic
1122663297 14:103312084-103312106 ACGGAGGCAAGGTGAGGGAGAGG + Intergenic
1122738872 14:103859446-103859468 AGGGAGGGAAGGAAGGGAAGGGG + Intergenic
1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG + Intronic
1202852336 14_GL000225v1_random:29752-29774 CCGGAGTGACGAAGAGGAAGGGG - Intergenic
1202856925 14_GL000225v1_random:57783-57805 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1202865366 14_GL000225v1_random:113923-113945 CCGGAGAGACGAAGAGGAAGGGG + Intergenic
1123872840 15:24594090-24594112 GCCTAGTGAAGCAGAGGAAGTGG - Intergenic
1124172409 15:27387929-27387951 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1124191215 15:27578833-27578855 ATGGGGTCATGGAGAGGAAGTGG - Intergenic
1124195528 15:27623304-27623326 ACGGAGGGAAGGCGTGGAGGCGG + Intergenic
1124581392 15:30958277-30958299 ACGGAGTGCCAGTGAGGAAGAGG + Intronic
1124788994 15:32708993-32709015 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1124991642 15:34680221-34680243 AAGTAGTGAAGGAGAGGAAGAGG + Intergenic
1125068163 15:35516772-35516794 ACTCAGTGATGGAGATGAAGAGG + Intronic
1125608661 15:40956609-40956631 AGAGAGGGAAGGAGAGGAAGAGG - Intergenic
1125613029 15:40985362-40985384 ACCGAGTGAAAGAGCGCAAGCGG - Exonic
1125638034 15:41205704-41205726 AAGGAGGGAAGGAGAGAAGGAGG + Intronic
1125848846 15:42885234-42885256 ACGGAGTGAGGGTGAGGACAGGG - Intronic
1126010783 15:44300189-44300211 AAGGAGGGAAGGAGAGAAAGAGG + Intronic
1126324407 15:47461009-47461031 GCAGAGTGAGAGAGAGGAAGTGG - Intronic
1126388515 15:48119928-48119950 AAGGAAGGAAGGAGAGAAAGAGG + Intergenic
1126414668 15:48405318-48405340 ACGAAGGGAGGGAGATGAAGAGG + Intergenic
1127215921 15:56823021-56823043 AAGGAGTGATGGTGAGGAGGTGG - Intronic
1127263905 15:57346132-57346154 TTGGAGTGAAGGAGAAGCAGAGG - Intergenic
1127346299 15:58103845-58103867 AAGGAGAGAAGGAGAAAAAGGGG - Intronic
1127410949 15:58706596-58706618 AAGGAGAGGAGGAGGGGAAGAGG + Intronic
1127858572 15:62973602-62973624 ATGAAGGGAAGGAGAGAAAGCGG + Intergenic
1127866826 15:63040344-63040366 AGGGAGTCTGGGAGAGGAAGAGG + Intergenic
1128264338 15:66253826-66253848 TGGGAGGGAAGGAGAGGGAGGGG - Intergenic
1128534178 15:68478362-68478384 AGGGAGTGGAGGAGAGGAATAGG - Intergenic
1128600066 15:68988614-68988636 ACGGAGTGAGGGTGAGGACAGGG - Intronic
1128713182 15:69887344-69887366 AGGGAGGGAAGGAGAAGAAAAGG - Intergenic
1129698213 15:77752654-77752676 AGGGAGGGAAGGAGAGGTAGGGG + Intronic
1130174324 15:81552233-81552255 AGAGAGGGGAGGAGAGGAAGAGG + Intergenic
1130556557 15:84926937-84926959 CCGGAGTGAAGGAGAGATGGAGG - Intronic
1130720377 15:86380561-86380583 AGGGAGTGAGGGAGGGGAAAGGG - Intronic
1131225012 15:90617205-90617227 ATGAAGTGCAGAAGAGGAAGAGG - Intronic
1131641558 15:94298976-94298998 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
1131726854 15:95235654-95235676 AGGGAGTGAAAGAGTGGAGGGGG + Intergenic
1131993727 15:98114549-98114571 ACTGAGTGGAGGCGAGGAGGTGG - Intergenic
1132169929 15:99640508-99640530 AGGGAGTGAAGGAGGGAGAGAGG - Intronic
1132209772 15:100011330-100011352 AGGGAGGGAAGGAAAGGAGGAGG + Intronic
1132358336 15:101190225-101190247 ACTGAGGGAAGAAGAGGGAGTGG + Intronic
1132664590 16:1075847-1075869 AGGGAGGGAGGGAGAGGGAGAGG - Intergenic
1133962960 16:10510405-10510427 AGGGAGGGAAGGGGAGGAAGGGG + Intergenic
1133981578 16:10636543-10636565 AGGGAGTGAGGGAGAAGAAGAGG + Intronic
1134133498 16:11665401-11665423 ACGGAGGGAGGTAGAGGAAATGG + Intergenic
1134268236 16:12710015-12710037 AGGGAGGGAAGGAAAGGAAAGGG + Intronic
1134286784 16:12868630-12868652 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1134316814 16:13126556-13126578 AGGGAGAGAGGGAGAGAAAGGGG + Intronic
1134316882 16:13127051-13127073 ACTGAGGGAAGGAGAGAGAGAGG + Intronic
1134321970 16:13172037-13172059 AGGAAGGGAAGGAGAGAAAGTGG - Intronic
1134331489 16:13255214-13255236 AAGAATTGAGGGAGAGGAAGAGG - Intergenic
1134332743 16:13265366-13265388 AGGGAGGGAAGGAAGGGAAGGGG - Intergenic
1134357805 16:13500625-13500647 AGGGAGAGAAGGAGGGGCAGGGG + Intergenic
1134394957 16:13854228-13854250 AGGGAGGGAAGGAGAGAAGGAGG + Intergenic
1134452694 16:14373277-14373299 ACTGAGTGCAGGAGAGGAACAGG + Intergenic
1134765688 16:16755708-16755730 AGGGGAAGAAGGAGAGGAAGGGG - Intergenic
1134980362 16:18603505-18603527 AGGGGAAGAAGGAGAGGAAGGGG + Intergenic
1135025638 16:18997128-18997150 ACGGAGTGAGGGCGAGGACAGGG + Intronic
1135050032 16:19185186-19185208 AGGGAGAGAAGGAAGGGAAGAGG - Intronic
1135533425 16:23274242-23274264 ACGAAGTCAGGGACAGGAAGCGG - Intergenic
1135784435 16:25336027-25336049 AGGGAGGGAAGGAGAGAGAGAGG - Intergenic
1135830456 16:25768397-25768419 ACAGAGAGAGGGAAAGGAAGGGG - Intronic
1136228463 16:28873757-28873779 AGGGGGTGATGGAGAGGAAGGGG + Exonic
1136597603 16:31262302-31262324 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1136989823 16:35145278-35145300 ATGGAGGGAAGCAGCGGAAGAGG + Intergenic
1137238695 16:46636623-46636645 AAGGAGGGAGGGAGAGGGAGAGG + Intergenic
1137549128 16:49424845-49424867 CCAGAGTGAAGGGGAGGAAAGGG - Intergenic
1137699455 16:50486343-50486365 AAGAAGAGAAGAAGAGGAAGAGG - Intergenic
1138549864 16:57741662-57741684 ACACAGGGAAGGAGAGGGAGAGG - Intronic
1138752514 16:59440793-59440815 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1138889163 16:61121375-61121397 AGGGAGAGAAGGATAGGGAGAGG - Intergenic
1138981709 16:62277162-62277184 AAGGAGAGAAAAAGAGGAAGAGG - Intergenic
1139278528 16:65750036-65750058 AAGGAGGGAGGGAGAGAAAGAGG + Intergenic
1139328459 16:66169551-66169573 AAGGAAAGAAGGGGAGGAAGAGG + Intergenic
1139345344 16:66299533-66299555 AGGGAGGAAGGGAGAGGAAGTGG + Intergenic
1139398238 16:66658242-66658264 AGGGAGGGAAGGAGAGAAGGAGG + Intronic
1139424977 16:66873828-66873850 AGGGAGGAGAGGAGAGGAAGGGG - Intergenic
1139946313 16:70644841-70644863 AAGGAGGGAAGAGGAGGAAGAGG + Intronic
1139998871 16:71006972-71006994 AGGGAGAGAGGGAGAGAAAGGGG - Intronic
1140139927 16:72245785-72245807 AGAGAGTGAAGGAGAGAGAGAGG - Intergenic
1140636403 16:76920001-76920023 ATGGAGTGAAGGAGAAAGAGAGG + Intergenic
1140929055 16:79610212-79610234 TAGGAGAGAAGGAGAGAAAGAGG - Intergenic
1141121594 16:81362765-81362787 AAGGAGTGAGGGCCAGGAAGGGG - Intronic
1141141594 16:81500089-81500111 ACAGAGTGAGGGAGGGAAAGAGG - Intronic
1141456141 16:84144053-84144075 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1141700042 16:85638250-85638272 AGGCTGGGAAGGAGAGGAAGAGG + Intronic
1142141264 16:88473809-88473831 ACAGGGTGAAGGTGAGGATGGGG - Intronic
1142332147 16:89462049-89462071 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
1142992196 17:3739012-3739034 AATGAGGGAAGGGGAGGAAGGGG - Intronic
1143200722 17:5111544-5111566 AGGGAGTGAAGGGTGGGAAGGGG - Intronic
1143417402 17:6759763-6759785 CCTGAGAAAAGGAGAGGAAGGGG + Intronic
1143475896 17:7203816-7203838 CCTGGGTGAAGGAGGGGAAGAGG + Exonic
1143552761 17:7641106-7641128 ACGGAGTGAAGGGGAGGCTCAGG - Intergenic
1143792160 17:9306350-9306372 ACTTAGGGAAGGAGAGGGAGTGG + Intronic
1144126787 17:12210413-12210435 ACGAAGAGAAGAAGAGGAGGAGG - Intergenic
1144541181 17:16144909-16144931 AAGGAGAGAGGGAGAGGGAGAGG - Intronic
1144798237 17:17907089-17907111 AGGCTGTGAAGGAGAGGCAGAGG + Intronic
1145807842 17:27747141-27747163 AGGGAGAGGAAGAGAGGAAGGGG - Intergenic
1145959727 17:28880359-28880381 GTGGGGTAAAGGAGAGGAAGAGG + Exonic
1146172686 17:30645807-30645829 AAAGAGTGGAGGAAAGGAAGGGG + Intergenic
1146346142 17:32061816-32061838 AAAGAGTGGAGGAAAGGAAGGGG + Intergenic
1146377610 17:32305156-32305178 AGGGAGGGAGGGAGAGGGAGGGG + Intronic
1146465230 17:33081002-33081024 AGGAAGGCAAGGAGAGGAAGAGG + Intronic
1147915834 17:43885175-43885197 AGAGAGAGAAGGAGAGAAAGAGG - Intronic
1148023399 17:44568455-44568477 ACGGCGTGGGGGAGAGGAAGGGG - Intergenic
1148035371 17:44656248-44656270 CCAGAGACAAGGAGAGGAAGGGG - Intergenic
1148145622 17:45362780-45362802 GGGGAGGGAAGGAGAGCAAGGGG + Intergenic
1148220493 17:45858461-45858483 AGGGAGGGGAGAAGAGGAAGTGG - Intergenic
1148548186 17:48532563-48532585 ACGGAGCTCAGGAGAGGAAAGGG + Intergenic
1148601854 17:48900223-48900245 ACGGAGTCCAGGAGAGTCAGGGG + Intergenic
1148679728 17:49466672-49466694 TGGGAGAGAAGGAGGGGAAGGGG + Intronic
1148744905 17:49912716-49912738 AGGGAGGGAAGGAGAGGGACAGG - Intergenic
1148900800 17:50875374-50875396 AAGTAGGGAAGGAGGGGAAGAGG - Intergenic
1149233172 17:54559781-54559803 AAAGAGTGATGGAGAAGAAGAGG - Intergenic
1149304591 17:55335624-55335646 AGGGAGAGAAGGAGAGGGGGAGG - Intergenic
1149404983 17:56339452-56339474 AGAGGGTGAAGGATAGGAAGAGG - Intronic
1149433797 17:56616751-56616773 ACAGAGGGAGGGAGAGGAAGAGG - Intergenic
1149614923 17:57988952-57988974 TTGGAGTGAAGGGGAGGATGGGG - Intergenic
1149749332 17:59129926-59129948 AAGGAAGGAAGGAGAGAAAGAGG + Intronic
1150576243 17:66433408-66433430 AAGGAGAGCAGAAGAGGAAGTGG - Intronic
1150747835 17:67830626-67830648 AGGGAGGGAGGGAGAGGGAGCGG + Intronic
1150914016 17:69417782-69417804 CCGGAGGGAGGGAGAGAAAGAGG + Intronic
1150943774 17:69722502-69722524 ACTGAGTGAGGAAGAGTAAGTGG + Intergenic
1151100505 17:71550805-71550827 AGGGAGGGAAGGAGGGGAAAGGG + Intergenic
1151133303 17:71920949-71920971 AGGGAGTGCAGGAGGAGAAGTGG + Intergenic
1151179791 17:72318913-72318935 AATGAGGGAAGGAGAGGAAGAGG - Intergenic
1151248773 17:72817325-72817347 AGGGAGGGAAGGAAAAGAAGGGG + Intronic
1151559059 17:74861203-74861225 CCGGAGAGAAGGCGAAGAAGAGG - Intronic
1151606778 17:75142588-75142610 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1151871648 17:76840820-76840842 AGGGAGTCAGGGAGAGAAAGAGG - Intergenic
1151956581 17:77383161-77383183 AAGGAGGGAGGGAGAGAAAGAGG - Intronic
1152000425 17:77641880-77641902 AGGAAGAGGAGGAGAGGAAGAGG + Intergenic
1152113391 17:78369888-78369910 CCACAGTGAAGTAGAGGAAGAGG - Intergenic
1152123707 17:78433966-78433988 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1152652963 17:81504543-81504565 AAGGAGGGAAGGAGAGAAGGAGG + Intergenic
1152697315 17:81803736-81803758 GCGGAGGGAGCGAGAGGAAGGGG + Intergenic
1152988697 18:343029-343051 AGTGAGTGAAAGAGAGGAACAGG - Intronic
1153279534 18:3401269-3401291 ACCTAGTGTAGGAGGGGAAGAGG + Intergenic
1153646976 18:7204226-7204248 AAGGAGAGAGGGAGAGGGAGAGG + Intergenic
1153699023 18:7673938-7673960 GCAGAGTGGAGGTGAGGAAGGGG + Intronic
1153871310 18:9322858-9322880 AGGGTGTAAAGGAGAGAAAGAGG - Intergenic
1154398517 18:14011880-14011902 ATGGGGAGAAGGAGAGGGAGAGG + Intergenic
1154974565 18:21444565-21444587 AAGAAATGAAGGAGAGGAAAGGG - Intronic
1154995297 18:21635031-21635053 AGGGAGTGAAGGAGGGCAACTGG - Intergenic
1155853580 18:30803241-30803263 GAGGAGTGAGGGAGAGAAAGAGG + Intergenic
1155871202 18:31030721-31030743 AGGGAGGGAAGAAAAGGAAGGGG + Intronic
1155961719 18:32000994-32001016 ACAGAGTGAGGGCGAGGACGGGG - Intergenic
1157353657 18:46914245-46914267 ATGGATTGAAGGAAAGGAAGTGG - Intronic
1157470132 18:47982541-47982563 AGGGAGGGAGGGAGAGGGAGGGG + Intergenic
1157475527 18:48021170-48021192 AGGGAGAGGAGGAGAGGAGGAGG - Intergenic
1157488675 18:48107407-48107429 AAAGAGGGAAGAAGAGGAAGAGG + Intronic
1157506095 18:48227840-48227862 AGGGAGAGAAGGAGAGGACAAGG - Intronic
1157768621 18:50324936-50324958 AGGAGGAGAAGGAGAGGAAGGGG - Intergenic
1158119306 18:54030587-54030609 AAGGAGGGAAGGAAAGGGAGCGG + Intergenic
1158125535 18:54096051-54096073 GAGGAGAGCAGGAGAGGAAGGGG - Intergenic
1158197519 18:54905344-54905366 AAGGAGGGTAGGGGAGGAAGGGG + Intronic
1158385131 18:56980808-56980830 ATGGAGTGAATGGGAGGAAAGGG + Intronic
1158809622 18:61017282-61017304 AGGGAGTGATGAAGAGGGAGAGG + Intergenic
1158848587 18:61470874-61470896 AGGGAGGGAGGGAGAGAAAGAGG - Intronic
1159618874 18:70614218-70614240 TAGGAGAGAAAGAGAGGAAGTGG - Intergenic
1160135297 18:76266344-76266366 AAGGAAGGAAGGAGAAGAAGGGG + Intergenic
1160295018 18:77630000-77630022 AAGGAGGGAAGGAGGGGGAGAGG - Intergenic
1160409554 18:78666670-78666692 GGGGTGTGCAGGAGAGGAAGGGG + Intergenic
1160711159 19:551615-551637 AGGGAGGGAAAGAGAAGAAGGGG - Intergenic
1160711166 19:551639-551661 AGGGAGGGAAAGAGAAGAAGGGG - Intergenic
1160785129 19:896748-896770 AAGGAGGGGAGGAAAGGAAGGGG + Exonic
1160840598 19:1145536-1145558 AAGGGGTGAAAGAGAAGAAGGGG + Intronic
1160872058 19:1282160-1282182 AAGGAGGGAAGGGGAGGAGGAGG + Intergenic
1161022278 19:2015874-2015896 AGGGAGGGGAGGAGAGGGAGGGG + Intronic
1161022295 19:2015912-2015934 AGGGAGGGGAGGAGAGGGAGGGG + Intronic
1161022312 19:2015950-2015972 AGGGAGGGGAGGAGAGGGAGGGG + Intronic
1161022329 19:2015988-2016010 AGGGAGGGGAGGAGAGGGAGGGG + Intronic
1161022346 19:2016026-2016048 AGGGAGGGGAGGAGAGGGAGGGG + Intronic
1161415615 19:4145110-4145132 AGGGAGGGAAGGGGAGGAGGGGG + Intergenic
1161633991 19:5375642-5375664 AGAGGGAGAAGGAGAGGAAGAGG + Intergenic
1161710937 19:5847674-5847696 AGGGAGTGAAGGTGAGGACAGGG - Intronic
1161845589 19:6710195-6710217 AAAGAGAGAAGGAGAGAAAGAGG + Intronic
1161918723 19:7250277-7250299 AAGGAGGGGAGGAGAAGAAGGGG + Intronic
1162012040 19:7823357-7823379 AGGGAGGGAAAGAGAGAAAGAGG + Intergenic
1162207211 19:9065071-9065093 AGGGGGAGAAGGAAAGGAAGAGG + Intergenic
1162261767 19:9539817-9539839 ACGGAGTGAGGGTGAGGACGGGG - Intergenic
1162421786 19:10569568-10569590 ACGGAGAGACGGAGTGGATGAGG + Intergenic
1162465249 19:10835834-10835856 ACGGTGTGTGGGAGCGGAAGGGG - Intronic
1162846082 19:13393750-13393772 AGGGAGGGAAGGGAAGGAAGGGG - Intronic
1162893556 19:13750975-13750997 ACAGAGTGAACGAGAGATAGAGG + Intronic
1162989750 19:14294277-14294299 AAAGAGTGGAGGAAAGGAAGGGG - Intergenic
1163004517 19:14389168-14389190 AGGGAGAGGGGGAGAGGAAGGGG + Intronic
1163176879 19:15570311-15570333 ACAGAGTGAGGGAGAGAGAGGGG + Intergenic
1163667257 19:18609115-18609137 GCGGAATGAGGGAGAGGAGGGGG - Intronic
1164071657 19:21775165-21775187 ACAGGGTGATGGAGAGGGAGAGG - Intergenic
1164234987 19:23323945-23323967 AAGAGGTGAAGGAGAGGAGGAGG - Intronic
1164250257 19:23469530-23469552 AAGAGGTGAAGGAGAGGAGGAGG - Intergenic
1164292445 19:23880379-23880401 GAGGAGAGAAGGAGAGGAGGAGG + Intergenic
1164302440 19:23973606-23973628 AGGAGGTGGAGGAGAGGAAGAGG + Intergenic
1164441157 19:28281906-28281928 AGGGAGAGAAGGGGAAGAAGAGG - Intergenic
1164521266 19:28982093-28982115 TCAGGGGGAAGGAGAGGAAGAGG + Intergenic
1164540385 19:29117625-29117647 AGAGAGGGAAGGAGAGGAGGTGG - Intergenic
1164668930 19:30062285-30062307 AGGGAGGGAAGGAAAGGAGGAGG - Intergenic
1165081703 19:33310684-33310706 AGGGAGTCAAGGAGCGGATGGGG - Intergenic
1165184787 19:34008514-34008536 AGAGAGAGAAAGAGAGGAAGAGG + Intergenic
1165463547 19:35958856-35958878 AGGGAGAGAGGGAGAGAAAGTGG + Intergenic
1165513272 19:36277245-36277267 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1166115552 19:40651601-40651623 AAGGAAAGAAGGAAAGGAAGGGG + Intergenic
1166297834 19:41897403-41897425 AGGGAGTGAAGGGGAGGGAGTGG - Intronic
1166349490 19:42188774-42188796 AGGGAGGGAAGGAAAGGGAGAGG + Intronic
1166580674 19:43895838-43895860 AGGGAGGGAGGGAGAGGGAGAGG + Intronic
1166611498 19:44203265-44203287 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1166908402 19:46132625-46132647 GGAGAGAGAAGGAGAGGAAGAGG + Intergenic
1167088034 19:47324050-47324072 CGGGAGGGAAGGGGAGGAAGAGG - Intergenic
1167154732 19:47731025-47731047 GCGCTCTGAAGGAGAGGAAGGGG + Intronic
1167224614 19:48229343-48229365 ACTAAGTGAAGGATAGGAAAAGG + Intronic
1167240819 19:48342153-48342175 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1167473604 19:49688309-49688331 CGGGAGGGAGGGAGAGGAAGGGG - Exonic
1167792741 19:51691270-51691292 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
1167797644 19:51720009-51720031 ACGGAGGGAGGGAGAGAGAGAGG - Intronic
1167898733 19:52602160-52602182 TCAGAGTGAGGGAGAGGAGGAGG + Intronic
1167903163 19:52637399-52637421 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167904557 19:52648020-52648042 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167913848 19:52724796-52724818 CCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167921352 19:52785792-52785814 CCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167925859 19:52820650-52820672 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167930045 19:52856639-52856661 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167934180 19:52892871-52892893 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167940356 19:52941694-52941716 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167946373 19:52992361-52992383 TCAGAGTGAGGGAGAGGAGGAGG - Intergenic
1167952208 19:53036920-53036942 AGAGAGTGAGGGAGAGGAGGAGG - Intergenic
1167995210 19:53396115-53396137 TCAGAGTGAGGGAGAGGAGGAGG + Intronic
1168148629 19:54433145-54433167 AGGGAGGGAAGGGAAGGAAGAGG + Intronic
1168348264 19:55661234-55661256 ATGGAGGGAAGGGGAGGAACGGG - Intronic
1168433175 19:56297361-56297383 AGGGAGGGAGGAAGAGGAAGAGG - Intronic
1168433187 19:56297406-56297428 AGGGAGGGAGGAAGAGGAAGAGG - Intronic
925022023 2:578371-578393 ACTGAGTGATGGGGAGGATGTGG + Intergenic
925230986 2:2233564-2233586 ACAGAAGGAAGAAGAGGAAGTGG + Intronic
925659187 2:6184321-6184343 ATGGAGGGAAGGAAAGAAAGAGG + Intergenic
925770174 2:7274515-7274537 AGTGAGTGAAGGAGAGGATGTGG + Intergenic
925867642 2:8243165-8243187 ACAGAGTGAAGGGTAGGAGGGGG + Intergenic
925907284 2:8547052-8547074 AGTGGGTGGAGGAGAGGAAGTGG - Intergenic
926010038 2:9400261-9400283 AGGGAAGGAAGGAGAGGAAGAGG - Intronic
926316891 2:11716405-11716427 AGAGAGTGAACGAGAGGGAGAGG - Intronic
926655808 2:15404460-15404482 ACAGAGGGAAAGATAGGAAGTGG - Intronic
926743391 2:16130549-16130571 AGGCAGTGAGGGAGAAGAAGAGG + Intergenic
926812832 2:16771624-16771646 AAGGAAGGAAGGAGAGGAGGAGG + Intergenic
927038414 2:19204188-19204210 AGGGGGTGAGGGAGAGGAGGAGG - Intergenic
927404033 2:22747512-22747534 ACAGAGTGATGAAGAGGAACAGG + Intergenic
927559516 2:24059966-24059988 ACAGAGGGAAGGGAAGGAAGGGG + Intronic
927702102 2:25275363-25275385 TCTGTGGGAAGGAGAGGAAGTGG - Intronic
928022551 2:27715850-27715872 GGGGAGGGAAAGAGAGGAAGAGG - Intergenic
928179016 2:29054548-29054570 ATGGCATGCAGGAGAGGAAGCGG + Exonic
929199539 2:39220407-39220429 ACAAAGTGAAACAGAGGAAGAGG + Intronic
929253012 2:39779679-39779701 GAGGAATGAAGGACAGGAAGAGG - Intergenic
929415811 2:41746059-41746081 AGGGAGGGACGGAGAGGGAGAGG - Intergenic
929433416 2:41907777-41907799 AGGGAGAAAAGGAGCGGAAGTGG + Intergenic
929822457 2:45284316-45284338 AGGGAGGGCAGGAGGGGAAGGGG - Intergenic
930044226 2:47155043-47155065 AGGGAGAGAAGGGTAGGAAGAGG + Intronic
930081158 2:47449879-47449901 AAGTAGGGAAGGAGAGGTAGTGG - Intronic
930156715 2:48113546-48113568 ACTCAAGGAAGGAGAGGAAGAGG + Intergenic
930194639 2:48496938-48496960 TTAGAGTGAAGCAGAGGAAGGGG - Intronic
930209811 2:48623903-48623925 AAGGAGAGAAGGAGAGAAGGGGG + Intronic
930270564 2:49251552-49251574 AGGGAGGGAGGGAGGGGAAGAGG - Intergenic
930571731 2:53094550-53094572 AGAGAGGGAAGGAGAGGAAAGGG + Intergenic
930907686 2:56592319-56592341 AGTGAGCAAAGGAGAGGAAGAGG + Intergenic
930927139 2:56831887-56831909 AGGGAGGGAAGGAAAGGAAAGGG + Intergenic
930937242 2:56969142-56969164 AGGGAGAGAAGGAGAGAGAGAGG + Intergenic
931620796 2:64207440-64207462 AAGGAGAGAGGGTGAGGAAGGGG + Intergenic
932108160 2:68968023-68968045 ACAGAGAGAAAGAGAGAAAGAGG + Intergenic
932284511 2:70520923-70520945 ACTGGGTGAAGGAGAGGGAAGGG - Intronic
933708469 2:85308470-85308492 AGGGAGGGAAGGAGGGGGAGAGG - Intronic
933940654 2:87242110-87242132 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
934781294 2:96971299-96971321 ACAGAGGGAAGGAGAGAGAGAGG - Intronic
934852918 2:97712779-97712801 AGGGAAGGGAGGAGAGGAAGAGG + Intergenic
934859453 2:97751794-97751816 ACGGTGAGAAAGGGAGGAAGAGG + Intergenic
935241019 2:101178336-101178358 ACGGAGTGAGGGTGAGGACCGGG + Intronic
935620523 2:105125899-105125921 AGGGAGGGAAGGAGAGAAGGAGG + Intergenic
935648471 2:105361824-105361846 AGGGAGTGTAGAAGAGGAAAAGG + Intronic
935673601 2:105575883-105575905 GCGGAGAGAAGGAAAGGGAGAGG + Intergenic
936233544 2:110724850-110724872 ACGGAGGGAAGGAAAGAAAGAGG + Intergenic
936722388 2:115268641-115268663 ATGGAGTGGAAGAGAGGCAGTGG + Intronic
937053403 2:118910622-118910644 AGAGAGGGAAGGGGAGGAAGAGG + Intergenic
937595268 2:123664597-123664619 GTGGAGTGAAGGAGGGGTAGTGG + Intergenic
937988416 2:127648990-127649012 AGGGAGGGGAGGGGAGGAAGGGG + Intronic
938125223 2:128666264-128666286 AAGAAGTGCAGGAGAAGAAGGGG - Intergenic
938782153 2:134594217-134594239 AAAGAGTGAAGGAGAGACAGGGG + Intronic
939671804 2:145022174-145022196 GTGGGGGGAAGGAGAGGAAGAGG - Intergenic
939684480 2:145181701-145181723 ATGGAATGAAGAAGAGTAAGTGG - Intergenic
939875046 2:147568287-147568309 ATGGAGGGAAGGAGGGAAAGAGG + Intergenic
940016551 2:149112086-149112108 AGAGAATGGAGGAGAGGAAGTGG + Intronic
940497869 2:154456947-154456969 AAGGAAGGAAGGGGAGGAAGAGG + Intergenic
940726651 2:157342997-157343019 ACGGAGTGAGGGTGAGGACCCGG + Intergenic
940787698 2:157999946-157999968 AAGGAGGGAAGGAGAGAGAGAGG + Intronic
940881244 2:158948972-158948994 AAGGAGTGTAAGAGAAGAAGGGG + Intergenic
941218828 2:162748870-162748892 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
941865828 2:170333346-170333368 ATGGAGTGAATGAGATAAAGAGG + Intronic
942449812 2:176101694-176101716 AGGGAGTGAATAAGAGGAGGAGG + Intergenic
942902386 2:181137281-181137303 AAAGAGTAAAGGAGAGAAAGAGG - Intergenic
942931761 2:181502236-181502258 ACGGGGGGAAGGAAAGGAATTGG + Intronic
942956209 2:181776519-181776541 CCCCAGTGAATGAGAGGAAGAGG + Intergenic
943116052 2:183671881-183671903 ACGCAGTGAAGGATATGAAGTGG + Intergenic
943375552 2:187072092-187072114 AGGGAGGGAGGGAGAGGGAGAGG + Intergenic
943471066 2:188293512-188293534 ACAGAGTGAATGTGAGGAAGTGG + Intronic
943839067 2:192554267-192554289 AGGAAGAGAAGGAGAAGAAGAGG + Intergenic
944001610 2:194845297-194845319 AAGGAGAGAAGGAGAGAAAGAGG + Intergenic
944599048 2:201284667-201284689 ACGGGGAGAGGGAGAGGGAGAGG + Intronic
944599057 2:201284693-201284715 ACGGGGAGAGGGAGAGGGAGAGG + Intronic
944775574 2:202960758-202960780 AAGGAGGGAAGGAGAGAAGGAGG - Intronic
944797770 2:203206381-203206403 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
944927430 2:204479495-204479517 ACTTAGTGAAGGTGAGGATGGGG - Intergenic
944931618 2:204525989-204526011 ATGGAAAGAAGGAGTGGAAGTGG + Intergenic
945313993 2:208350695-208350717 AGGGAGTGAGGGAGCGGAGGAGG + Intronic
945318279 2:208393545-208393567 AGAGAGGGAAGGTGAGGAAGAGG - Intronic
945344554 2:208697537-208697559 AGAGAGAGAAGGAAAGGAAGAGG - Intronic
945577838 2:211554478-211554500 ACGCAGTGCTGGAGAGGAAGTGG + Intronic
945721486 2:213422648-213422670 TGGGAGGGAAGGAGAGTAAGGGG - Intronic
945939421 2:215933229-215933251 ACTGAGTGAAAGAGATGGAGAGG - Intergenic
945958208 2:216105904-216105926 ACAGGGAGAAGGAGAAGAAGGGG + Intergenic
946015876 2:216603338-216603360 AGGAAGGGGAGGAGAGGAAGGGG + Intergenic
946064148 2:216971982-216972004 AAGGAATGAAGAAGAGGCAGTGG + Intergenic
946285307 2:218698197-218698219 ATGGACTGATGGAGAGGAGGAGG - Intronic
946415589 2:219538296-219538318 AGGGAAGGAAGGAGAGGGAGGGG + Exonic
946642367 2:221798249-221798271 AAAGAATGAAGGAGAGAAAGAGG - Intergenic
946713142 2:222526442-222526464 ATGGAGGGAAGGAGGGGAGGAGG + Intronic
947018246 2:225645404-225645426 AGGGAATGAAGGAGAGAAGGAGG - Intronic
947135274 2:226971187-226971209 CAGGAGTGAATGAGAGCAAGAGG - Intronic
947661222 2:231870026-231870048 AGGGAGGGAGGGAGAGGGAGGGG - Intergenic
948035807 2:234857575-234857597 ACAGAGAGAAAGAGAGAAAGAGG + Intergenic
948233214 2:236366782-236366804 AAGGAGGGAGGGAGAGGGAGAGG - Intronic
948268870 2:236658410-236658432 AGGGAGAGAAGGAGAGAAGGAGG - Intergenic
948689611 2:239693778-239693800 AGGGGGTGAAGTAGAAGAAGGGG - Intergenic
949062879 2:241971441-241971463 AGGAAGTCTAGGAGAGGAAGGGG + Intergenic
1169091931 20:2866193-2866215 AAGGCTTGGAGGAGAGGAAGCGG - Exonic
1169214405 20:3785157-3785179 AGGGGGGGAAGGAGAGGAATTGG - Exonic
1169214424 20:3785208-3785230 AGAGGGTGAAGGAGAGGAAGAGG - Exonic
1169214436 20:3785259-3785281 CAAGAGTGAGGGAGAGGAAGAGG - Exonic
1169581288 20:7026251-7026273 GCGGGGGGAAAGAGAGGAAGGGG - Intergenic
1169679863 20:8198892-8198914 AAAGTGTGAAGGAGAGAAAGAGG + Intronic
1169936035 20:10884353-10884375 AGGGAGGGAAGGAGAGGAACAGG + Intergenic
1170545713 20:17434230-17434252 AGGGAGAGAAGGAGAGAGAGAGG - Intronic
1170633918 20:18088472-18088494 AAGGAGGGAAGGAGAGAAGGAGG - Intergenic
1170731639 20:18981065-18981087 AGGGAGAGAAGGAAAGAAAGAGG - Intergenic
1170749382 20:19131780-19131802 AGGGAGGGAGGGAGAGCAAGAGG - Intergenic
1170770948 20:19332059-19332081 AGGGAGAGAAGGAGAAGAATTGG + Intronic
1170781608 20:19430464-19430486 AGGGAGGGAAGGAGAGCAAGGGG + Intronic
1171114535 20:22513235-22513257 AGGGAGAGAAGGAGAGAGAGAGG - Intergenic
1171207291 20:23290900-23290922 CCTGGGTCAAGGAGAGGAAGTGG - Intergenic
1171905820 20:30899263-30899285 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1171905840 20:30899319-30899341 AGGGATAGAAGGAGAGGGAGAGG - Intergenic
1172024379 20:31938071-31938093 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1172024389 20:31938097-31938119 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1172024397 20:31938117-31938139 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1172307858 20:33894346-33894368 ACGGAGGCAGGGAGTGGAAGAGG + Intergenic
1172554889 20:35832253-35832275 AAGGGGAGAGGGAGAGGAAGGGG - Intronic
1172735636 20:37125181-37125203 AAGGGGAGAAGGAGAGGGAGAGG - Intronic
1173001807 20:39110381-39110403 GAGGAGAGAAGGAAAGGAAGGGG - Intergenic
1173607401 20:44341324-44341346 ACTGAGTGAAGGAAGGGCAGAGG - Intronic
1173651739 20:44670740-44670762 ACGGAGTGAGGGTGAGGACAGGG - Intergenic
1173857163 20:46257891-46257913 ACAGAGAGAAGGGGAGGAAAAGG + Intronic
1174062733 20:47843999-47844021 AGGGAGGGAAGGAGAGGGAAGGG + Intergenic
1174135307 20:48375011-48375033 ATGGAGAGAGGGAGGGGAAGGGG + Intergenic
1174221569 20:48959590-48959612 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1174290943 20:49508084-49508106 AAGGTGTGAAGGAGAGGAGTAGG + Intronic
1174316788 20:49709386-49709408 AGAGAGTGAAAGAGAGAAAGTGG - Intronic
1174519867 20:51121120-51121142 AGTGAGGGAAGGCGAGGAAGAGG + Intergenic
1175408151 20:58748331-58748353 AGGGATTGAAGGATATGAAGGGG + Intergenic
1175452106 20:59077971-59077993 AGGAAGGGAAGGAGAAGAAGAGG + Intergenic
1175553488 20:59831782-59831804 ATGTAGTGAGGGAGAGGAACCGG + Intronic
1175717161 20:61262833-61262855 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
1175772550 20:61632819-61632841 GGGGAGAGGAGGAGAGGAAGAGG - Intronic
1176161272 20:63650170-63650192 AGGGAGTCAAAGAGAGGGAGGGG - Intronic
1177264947 21:18770446-18770468 ATGAAGGGAAGGGGAGGAAGAGG - Intergenic
1177327376 21:19608617-19608639 AAGAAGAGAAGGAGAGAAAGGGG + Intergenic
1178016135 21:28347654-28347676 AAGGAAGGAAGGAGAAGAAGAGG - Intergenic
1178238993 21:30877352-30877374 AGGGAGGAAAGGAGATGAAGAGG + Intergenic
1178319869 21:31597218-31597240 AAGGAGGGAGGGAGGGGAAGGGG - Intergenic
1178360439 21:31944632-31944654 AGGGAGTCAAGGAGGAGAAGGGG + Intronic
1179016877 21:37601575-37601597 ATGGGAAGAAGGAGAGGAAGTGG - Intergenic
1179163720 21:38918680-38918702 AAGGGGTGCAGGAGAGGAAGAGG - Intergenic
1179633478 21:42692786-42692808 ACCGAGTGGAGGAGAGGAAGAGG - Intronic
1179958687 21:44756039-44756061 CTGGAGTGATGGAGAAGAAGAGG + Intergenic
1180938571 22:19641946-19641968 ACGAAGGGAAGGAGAAGAGGTGG + Intergenic
1181375591 22:22455300-22455322 AGGGAGAGAAAGAGAGGCAGAGG + Intergenic
1181522330 22:23456865-23456887 ACGGAGTGAGGGAGGGGTGGAGG - Intergenic
1181534378 22:23534092-23534114 AGGGAGGGAAGGGCAGGAAGAGG + Intergenic
1181545272 22:23598874-23598896 ACCGAGATCAGGAGAGGAAGGGG - Intergenic
1181908770 22:26221032-26221054 AAGAAGAGAGGGAGAGGAAGAGG + Intronic
1181924721 22:26348873-26348895 GGGGAGTGAAGGGGAGGGAGGGG + Intronic
1181938189 22:26453926-26453948 AGGGAGTGAAGGACAGGAGTGGG + Intronic
1182007046 22:26969723-26969745 AAGGAGGGAAGGAGAGAGAGAGG - Intergenic
1182045096 22:27267983-27268005 AGGGAGGGGAGGTGAGGAAGCGG - Intergenic
1182057299 22:27369660-27369682 ACAGAGTGAGGGGGAGGAGGAGG + Intergenic
1182103288 22:27672073-27672095 AGGGAGGGAGGGAGAGAAAGAGG + Intergenic
1182399655 22:30066060-30066082 ACAGAGGGAGGGAGAGGGAGAGG - Intergenic
1182725837 22:32444709-32444731 AAGGAATGAAGGATAAGAAGAGG - Intronic
1182962422 22:34488238-34488260 ACGGAAGGAAGGAAGGGAAGGGG - Intergenic
1183334041 22:37236633-37236655 ATGGAGTGGAGGAGGGGAATGGG + Intronic
1183410724 22:37653754-37653776 GCAGAGGGAAGGAGAGGATGGGG - Intronic
1183410903 22:37654597-37654619 TGGCAGTGAAGGAGAGGAGGTGG + Intronic
1183419731 22:37704448-37704470 ACAGGGAGAAGGAGGGGAAGGGG + Intronic
1183848416 22:40562612-40562634 AAGGGGGGAGGGAGAGGAAGGGG + Intronic
1184269446 22:43370482-43370504 AGGGGGTGAAGGACAGGAACAGG - Intergenic
1184422825 22:44391734-44391756 AGGGAGTGGAGGAGAGGAAGGGG - Intergenic
1203314471 22_KI270736v1_random:173636-173658 ATGGAATGAAGTGGAGGAAGGGG + Intergenic
949154019 3:807680-807702 AGGGAATGAGTGAGAGGAAGAGG - Intergenic
949508047 3:4744978-4745000 AAGGAGAGAAGGAGGGAAAGAGG - Intronic
949862003 3:8514359-8514381 ACAGAGTGCTGGAGAGGATGTGG + Intronic
950132755 3:10558527-10558549 ACTGAGAGATGGAGAGGAAGGGG + Intronic
950235931 3:11320172-11320194 ACGGAGCAAAGGGGAGGTAGGGG - Intronic
950268479 3:11593638-11593660 AGGGAGGGAAGAGGAGGAAGAGG + Intronic
950401581 3:12773185-12773207 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
951069700 3:18312688-18312710 ACGGAGGGAGGGAGAGAGAGAGG + Intronic
951431845 3:22617017-22617039 ACGGAGGGAGGGAGAGAAAGAGG + Intergenic
952312150 3:32199926-32199948 AGGGAGTGAGGAAGAGGAATAGG + Intergenic
952379882 3:32796390-32796412 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
952381801 3:32811116-32811138 AATGAGTGAAGGAGAGGACTAGG + Intergenic
952405065 3:32997950-32997972 TTGGGGTGAGGGAGAGGAAGAGG + Intronic
952791737 3:37205890-37205912 ACAGAGTGAGGGTGAGGATGGGG - Intergenic
953082305 3:39632148-39632170 AAGGAGGGAAGGAGAGAAGGAGG - Intergenic
953111223 3:39941089-39941111 AGGGAGTGTACAAGAGGAAGGGG + Intronic
954000122 3:47549939-47549961 AGAAGGTGAAGGAGAGGAAGAGG - Intergenic
954078309 3:48197122-48197144 AAGGTATGAAGGTGAGGAAGAGG - Intergenic
954626593 3:52025225-52025247 ACGGGGTGGAAGAGAGGAACTGG + Intergenic
954915044 3:54141515-54141537 AGGAAGAGAAGGAGAGGCAGAGG + Intronic
955072958 3:55587131-55587153 AAGGAAGGAAGGAGAGGAAGGGG - Intronic
955626785 3:60927504-60927526 ACGGGGTGAAGGCCAGGAAGAGG - Intronic
956198833 3:66684127-66684149 AGGGAAAGAAGGAGAAGAAGAGG - Intergenic
957058957 3:75466154-75466176 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
957134892 3:76273982-76274004 AGGGAGAGAAAGAGAGCAAGAGG + Intronic
957158437 3:76576958-76576980 AAGGAGGAAAGGAGAGGAATAGG + Intronic
957831642 3:85529679-85529701 AAGCAGTGACGGAGAGGATGGGG - Intronic
958431209 3:94043630-94043652 GGGGAGGGAAGGAGAGGGAGGGG - Intronic
958767408 3:98386379-98386401 AGAGAATGAAGAAGAGGAAGAGG - Intergenic
959032647 3:101318548-101318570 AAGAAGGGAAGGACAGGAAGAGG + Intronic
959265536 3:104132724-104132746 AAGCAGTGAAGTAAAGGAAGTGG - Intergenic
959351975 3:105277007-105277029 AGGGAGAGAGGGAGAGAAAGAGG + Intergenic
959420696 3:106124669-106124691 AGGGGGAGAAGGAGAGGAAAGGG - Intergenic
959926129 3:111923858-111923880 ATGGATTGAAGGAAAGCAAGTGG - Intronic
960141838 3:114158826-114158848 ACTGGGAGAAGGAGAAGAAGCGG + Intronic
960447194 3:117763090-117763112 AAGGACTGAGGGAGAGGGAGGGG + Intergenic
960467756 3:118018609-118018631 ATGGAGCGACGGTGAGGAAGTGG - Intergenic
960881323 3:122348247-122348269 AAGGAGAGAGGAAGAGGAAGTGG + Intergenic
960891485 3:122452732-122452754 ACGGAGGGAAGGAGAGACAGAGG + Intronic
961460267 3:127045586-127045608 AAGGAGGGAGAGAGAGGAAGAGG + Intergenic
961517380 3:127446365-127446387 CCAGAGTGAAGGAGCAGAAGTGG + Intergenic
961522761 3:127476732-127476754 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
961554430 3:127688495-127688517 ACTGGGTGCAGGAGAGAAAGCGG + Intergenic
961804535 3:129479813-129479835 GCGGAGTGAAGGAGCGGGAGTGG + Exonic
961861077 3:129917162-129917184 ACTCAGTGCAGGAGAGTAAGGGG + Intergenic
962063012 3:131951515-131951537 AGAGGGTGAAGGAGAGGGAGAGG - Intronic
962366271 3:134786353-134786375 ATGGGGAGAAGGAGAAGAAGTGG - Intronic
962526174 3:136239567-136239589 CCTGAGTGAATGAGAGAAAGAGG - Intergenic
962816360 3:139004898-139004920 AAGGAGTTAAGGAGAGCAAGTGG + Intergenic
963987797 3:151617245-151617267 AAGAAGAGAAGGAGAAGAAGAGG - Intergenic
964619152 3:158703535-158703557 AAGGATGGGAGGAGAGGAAGTGG - Intronic
964664273 3:159154904-159154926 AGGGAGTAAAGGGGAGGGAGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965202506 3:165677477-165677499 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
965329161 3:167348437-167348459 AGAGAGAGAAGGAGAGAAAGAGG + Intronic
965649896 3:170922976-170922998 ACGGAGAGAGGGAGAGGTAGAGG - Intergenic
966675854 3:182589046-182589068 ACTGAGTGTTGGAGAGGATGTGG + Intergenic
966762615 3:183430604-183430626 AAGGAATGGAGGAGAGGAAAAGG + Intergenic
966846580 3:184135266-184135288 ACGAAGGGAAGGAGACGAGGAGG - Exonic
966941849 3:184752892-184752914 AAGGAGTAAAGGCTAGGAAGTGG + Intergenic
967197618 3:187042421-187042443 AGGGAGTGGAAGAGTGGAAGAGG + Intronic
967414828 3:189204626-189204648 ACAGCCTGAGGGAGAGGAAGTGG + Intronic
967420137 3:189263296-189263318 TAGGAGTTAAGGAGATGAAGGGG + Intronic
967912660 3:194555262-194555284 ACAGAGGGCAGGAGAGGCAGTGG - Intergenic
968339318 3:197941478-197941500 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
968583109 4:1403955-1403977 ACAGAGCGAAGGAGAGAGAGAGG - Intronic
968940090 4:3633286-3633308 AAGGAGGGAGGGAGGGGAAGGGG - Intergenic
968957430 4:3726406-3726428 AGGGAGGGAGGGAGAGGGAGAGG + Intergenic
969398491 4:6938445-6938467 AAGGACTGAAGAAGAGGAAGTGG - Intronic
969668491 4:8575937-8575959 AGGGAGGGAGGGAGAGGGAGGGG - Intronic
969928962 4:10611777-10611799 AAGAAGTGGAGGAAAGGAAGGGG - Intronic
970181017 4:13394118-13394140 ACAGAGTGAAAGAGAGGAGTAGG + Intronic
970311654 4:14788229-14788251 AAGGAGTGAGGGGAAGGAAGGGG + Intergenic
970703054 4:18765962-18765984 AAGGAGGGAGGGAGAGGTAGGGG - Intergenic
970915007 4:21322083-21322105 AAGGAGGGAAGGAGAAAAAGAGG + Intronic
971243471 4:24909195-24909217 ACTGATTGAAAGAGAGGACGGGG + Intronic
971251428 4:24976020-24976042 AGGGAGGGAAGGAGAGGGAGGGG + Intronic
971360121 4:25930404-25930426 AGGGAGGGAAGGAAAGAAAGAGG - Intergenic
972142055 4:35973228-35973250 AGGGAGGGAAGGAAAGGAAAGGG + Intronic
972209609 4:36821794-36821816 ATGGAGGAAAGGAGAGGAAGGGG + Intergenic
972281455 4:37605928-37605950 AGAGAGAGAAGGAGAGAAAGAGG + Intronic
972999677 4:44930707-44930729 AGGGAGAGAAGAAAAGGAAGGGG + Intergenic
974145563 4:57943246-57943268 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
975637246 4:76462749-76462771 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
976222589 4:82769790-82769812 ACAGAGTGAGAGGGAGGAAGGGG + Intronic
976519973 4:86015422-86015444 AAGAAGTGAAAGACAGGAAGTGG - Intronic
977227857 4:94414660-94414682 AGGGAGAGAAAGAAAGGAAGTGG - Intergenic
978454061 4:108868649-108868671 AGGGAAAGAAGGAAAGGAAGGGG + Intronic
978720579 4:111903884-111903906 ATGAAGAGAAAGAGAGGAAGAGG + Intergenic
978977896 4:114901795-114901817 AAGAAGAGAAGGAGTGGAAGGGG - Intronic
979277789 4:118832441-118832463 ATGGAGGGAAGGAGAGGTAAAGG + Intronic
981023556 4:140053307-140053329 AGTCAGTGAAGGAGATGAAGGGG - Intronic
981083338 4:140657164-140657186 AAGGAGTGGAGGTGAGGAATGGG + Exonic
981532610 4:145766589-145766611 ACGGAGTATCAGAGAGGAAGGGG + Intronic
981832165 4:149014849-149014871 AAGAAGTGGAGGAGAGGAGGGGG - Intergenic
982133315 4:152249140-152249162 AAAGAGTGAAGAGGAGGAAGAGG + Intergenic
982453202 4:155576868-155576890 AAGGAATGAAGGAGGGGCAGGGG + Intergenic
982924990 4:161325452-161325474 ACAGTGTGAAAGAGAGGGAGAGG + Intergenic
983050483 4:163040325-163040347 AGGGAGGGAGGGAGAGGCAGGGG + Intergenic
983157328 4:164365908-164365930 ATGAAGTGAAGGATAGGAGGAGG - Intronic
983252726 4:165363126-165363148 AGGGAGTGAAGGAGAGGGACAGG - Intronic
983387408 4:167082773-167082795 AGGGAGGGAAGGGAAGGAAGGGG + Intronic
983387423 4:167082829-167082851 AGGGAGGGAAGGAAGGGAAGAGG + Intronic
983426718 4:167593516-167593538 AGGGAGGGAAGGAGAGAAAGAGG - Intergenic
983604370 4:169569427-169569449 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
984026471 4:174548676-174548698 CTGGAGGGAAGGAGAGGAAATGG + Intergenic
984182872 4:176506966-176506988 AAGGAGAGAGAGAGAGGAAGGGG - Intergenic
984189581 4:176589374-176589396 AGGGAGTGCAGAAGAAGAAGTGG + Intergenic
984411484 4:179403932-179403954 ACGGAGTGATGGTGAGGACAGGG - Intergenic
984863168 4:184257547-184257569 AAGGAGGGAAGGAGTGGGAGTGG + Intergenic
984927427 4:184819017-184819039 AGTGAGTGTAGGTGAGGAAGGGG + Intronic
985117291 4:186604889-186604911 GAGGAGTGTAGGAGAAGAAGAGG + Intronic
985140979 4:186840523-186840545 GAGGAGAGAAGGAGAGGGAGTGG - Intergenic
985451962 4:190067586-190067608 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985452949 4:190070877-190070899 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985453938 4:190074170-190074192 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985454926 4:190077463-190077485 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985455912 4:190080760-190080782 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985456897 4:190084054-190084076 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985457885 4:190087350-190087372 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985458873 4:190090647-190090669 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985463125 4:190173410-190173432 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
985873951 5:2581214-2581236 AAAGAGAGAAAGAGAGGAAGAGG - Intergenic
985985881 5:3515872-3515894 ACAGAGTGAAGAAGAGGGTGGGG + Intergenic
986125629 5:4880468-4880490 AGGGAGTGAGAGACAGGAAGGGG + Intergenic
986151753 5:5136510-5136532 AGGGAGGGATGGAGAGGGAGGGG - Intergenic
986601046 5:9473612-9473634 AAGGAGGGAAGGAGCTGAAGAGG + Intronic
988539468 5:32096202-32096224 ACGGATTGATGGGGAGAAAGAGG - Intronic
988829129 5:34970666-34970688 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
988872752 5:35409187-35409209 AAGGAGAGAAGGAAAGGCAGAGG + Intergenic
989060161 5:37402915-37402937 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
989466673 5:41764681-41764703 ATGGAGAGAAGAAGAGAAAGAGG - Intronic
989648945 5:43666603-43666625 AGGGAGAGAAGGAGAGGGAGAGG + Intronic
990043301 5:51398247-51398269 AGGGAGCGAAGGAGGGGGAGGGG + Intergenic
990743043 5:58931933-58931955 AGGGAGTGAATGGGAGGCAGAGG - Intergenic
991029843 5:62071393-62071415 AGGGAGGGTTGGAGAGGAAGGGG - Intergenic
991187639 5:63828895-63828917 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
991559898 5:67939450-67939472 GCGGGCGGAAGGAGAGGAAGGGG + Intergenic
992071693 5:73154684-73154706 AGGGAGGAAGGGAGAGGAAGGGG - Intergenic
992087388 5:73290297-73290319 GAGGACTGAAGGAGAGGAACAGG - Intergenic
992332218 5:75729052-75729074 AGAGAGTGAAGGAGAGTAAGAGG + Intergenic
992530049 5:77644958-77644980 AGGGAGGGAAGGAGAAAAAGGGG - Intergenic
992541164 5:77765577-77765599 ACCAAGTGAAAGAGAGGAAAAGG - Intronic
992605135 5:78448023-78448045 ACGGGGAGAAGGGGAGGAGGGGG - Intronic
992865889 5:80956854-80956876 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
993021128 5:82592431-82592453 AGGAGGAGAAGGAGAGGAAGAGG - Intergenic
993156216 5:84227919-84227941 AGAGAGTGGAGGAGAGGAAGAGG + Intronic
993575319 5:89592408-89592430 ACGGAAGGAGGGAGAGGATGAGG - Intergenic
994376077 5:99016452-99016474 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
994439356 5:99783239-99783261 AAGGAGGGAAGGAGAGAGAGAGG - Intergenic
994640993 5:102409963-102409985 ATAAAATGAAGGAGAGGAAGTGG + Intronic
994973174 5:106769506-106769528 TCTGAGAGAAGGAGGGGAAGAGG + Intergenic
995193068 5:109340391-109340413 ACGGAAGGAAGGAAAGGAATGGG + Intronic
995630721 5:114129188-114129210 AGGGAGAAAAGGAGAGTAAGGGG - Intergenic
995996325 5:118304830-118304852 AAGGAGGGAAGGAGGGGAAGAGG + Intergenic
996056354 5:118987551-118987573 AAGCAGTGAAGGAAAGGAATGGG - Intronic
996070286 5:119123447-119123469 AGGGAGAGGAGGAGAGGTAGAGG + Intronic
996408569 5:123130305-123130327 AGGGAGAGAAGGAAGGGAAGGGG - Intronic
996694463 5:126378641-126378663 ACTGAGTGAAGGAATGGATGTGG + Intronic
996696686 5:126404736-126404758 ACTAAGAGGAGGAGAGGAAGAGG + Intronic
996890615 5:128414778-128414800 AATGAGTGAAGGTGAGGATGTGG - Intronic
997076082 5:130679025-130679047 AAGGAGGGAAGGAAAGGAAGGGG + Intergenic
997113269 5:131098622-131098644 AGGAAGAGAAGGAGAGGGAGAGG + Intergenic
997256158 5:132429732-132429754 ACAGAGGGAAACAGAGGAAGGGG - Intronic
997924628 5:138018056-138018078 ACAGGGTGAAGAAGAGGAAAGGG - Intronic
998490120 5:142539491-142539513 AGGGAGGGAAGGAGGGGAGGGGG - Intergenic
998734674 5:145122983-145123005 AGGGAGGGAAGGAGAGAGAGAGG - Intergenic
998735171 5:145129265-145129287 AGGGAGTGAAGGGGGAGAAGTGG + Intergenic
998998317 5:147891371-147891393 AGGCAATGAAGGGGAGGAAGAGG + Intronic
999084799 5:148878135-148878157 AGGAAGGGAAGGAGAGAAAGGGG - Intergenic
999917336 5:156277272-156277294 AGGGAGAGAGGGAAAGGAAGAGG - Intronic
1000115371 5:158148928-158148950 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1000309399 5:160027396-160027418 TCGAAGTGGAGGAGAGGAAATGG - Intronic
1000409947 5:160927834-160927856 ACACAGTGAGGGAGAGGAATTGG + Intergenic
1000600773 5:163272249-163272271 ACAGAGTGAGAGAGAGGAGGTGG - Intergenic
1001129681 5:169053697-169053719 AGGGAGTGAATGAAAAGAAGGGG - Intronic
1001330903 5:170761720-170761742 AAGGGGAGAGGGAGAGGAAGTGG - Intergenic
1001354750 5:171008343-171008365 ACGGAGTGAGGGTGAGGACAGGG + Intronic
1001380302 5:171301813-171301835 ACTGAGGGAGGAAGAGGAAGTGG + Intergenic
1001563717 5:172686402-172686424 GCTGAGGGAAGGAGAGGATGCGG - Intronic
1001581131 5:172799270-172799292 AGGTAGAGAAGGAGAGGATGAGG - Intergenic
1001634323 5:173198852-173198874 AGGGAGAGAGAGAGAGGAAGAGG - Intergenic
1001653352 5:173330093-173330115 TCGGAAGGAAGGAGAGGAGGGGG + Intergenic
1001692340 5:173642450-173642472 AGGGTGGGAAGGAGAGGAGGAGG + Intergenic
1001892127 5:175348418-175348440 AGGAGGGGAAGGAGAGGAAGAGG - Intergenic
1001959412 5:175871360-175871382 AGGGAGAGAAGGAGGGGACGAGG + Intronic
1003003620 6:2360435-2360457 ACTGAGTGTAGGATAGGAAAAGG + Intergenic
1003015359 6:2463246-2463268 ACCGAGTGAAGGAGAGAGGGGGG - Intergenic
1003313554 6:4990473-4990495 AGGGAGAGAAGGAGAGAGAGAGG - Intergenic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1003487856 6:6595251-6595273 AAGGAGGGAAGGGGAGGAGGAGG + Intronic
1004053818 6:12114175-12114197 AAGGAGTGAAGGAGGGCATGAGG - Intronic
1004280863 6:14278512-14278534 ACGGGGAGGAGGAGAGGGAGAGG + Intergenic
1004636462 6:17472713-17472735 AAGGAAGGAAGGAGAGGCAGGGG + Intronic
1004745961 6:18509555-18509577 AGGGAGGGAAGGATAGGGAGAGG - Intergenic
1005570302 6:27139124-27139146 AAGGACTGAAGGAGAACAAGAGG + Exonic
1005786819 6:29252296-29252318 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
1006103561 6:31702272-31702294 TCAGAGTGAGGGTGAGGAAGAGG - Intronic
1006303764 6:33207399-33207421 ACGGACTGAAGGAGAGGACAGGG + Intergenic
1006832503 6:36977359-36977381 TCAGAGAGCAGGAGAGGAAGAGG + Intronic
1007476578 6:42123533-42123555 AGGAGGAGAAGGAGAGGAAGAGG + Intronic
1008532877 6:52480827-52480849 ATTGAGTGAGTGAGAGGAAGAGG + Intronic
1008606972 6:53150042-53150064 AAGGCGTGAAGGACTGGAAGAGG + Intergenic
1008863230 6:56176895-56176917 AGGGAGGAAAGGGGAGGAAGGGG + Intronic
1008869931 6:56261156-56261178 GCAGAGTGAGGGAGAGGGAGAGG - Intronic
1009344840 6:62600628-62600650 ATTTAGTGAAGGAGAGGAGGAGG - Intergenic
1009761552 6:68013064-68013086 AAGGAAGGAAGGAGAGAAAGAGG + Intergenic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1010513999 6:76751578-76751600 ATAGAGTAAAGGAGGGGAAGTGG - Intergenic
1010734052 6:79422750-79422772 ACAGAATCAATGAGAGGAAGAGG + Intergenic
1011154373 6:84313748-84313770 AAGGAGGGAAGGAGGAGAAGAGG - Intergenic
1011602918 6:89076634-89076656 ACAGAGAGAGGGAGAGAAAGAGG + Intergenic
1012201489 6:96411675-96411697 AGAGAGTGAAGAAGAGAAAGAGG - Intergenic
1012596011 6:101041100-101041122 AAAGAAGGAAGGAGAGGAAGAGG - Intergenic
1012813705 6:103994563-103994585 ATGGAGTAAAGGAAAGGAATTGG + Intergenic
1013256815 6:108395795-108395817 AGGGAGGGAAGGAGAGAGAGAGG + Intronic
1013534880 6:111054886-111054908 ACGGAGGGCTGGAGTGGAAGAGG + Intergenic
1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG + Intronic
1013681544 6:112529699-112529721 AAGGAGTAAAGGAGGGGATGAGG - Intergenic
1013836354 6:114341165-114341187 AGGGAGGGAGGGAGAGGGAGAGG + Intronic
1014023428 6:116616892-116616914 CAGGGGAGAAGGAGAGGAAGAGG - Exonic
1014079735 6:117272247-117272269 AGGGAGGGAAAGAGAGGGAGAGG - Intronic
1014115581 6:117664702-117664724 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
1014411115 6:121122436-121122458 AAGGAGTAAAGGAGAGGAATTGG - Intronic
1014485116 6:121989681-121989703 GTGGAGTGGAGAAGAGGAAGTGG - Intergenic
1014559565 6:122873939-122873961 AAGAAGGGGAGGAGAGGAAGGGG - Intergenic
1014960598 6:127679451-127679473 CTGGACTGAAAGAGAGGAAGTGG - Intergenic
1015090212 6:129347031-129347053 ACAGAGTGAATGAGAAGAGGGGG + Intronic
1015344924 6:132145084-132145106 AAAGACTGAAGGAGAGAAAGGGG - Intergenic
1015387942 6:132647511-132647533 AGGGAGGAAAGGAGAGGAGGAGG + Intergenic
1015486813 6:133780978-133781000 AAGCAGTGAGGGAAAGGAAGAGG + Intergenic
1015489770 6:133812417-133812439 AAGGAGAGAAGGGGAGGAAAGGG + Intergenic
1015771184 6:136769841-136769863 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1016382416 6:143498598-143498620 AGTGCCTGAAGGAGAGGAAGTGG + Intronic
1016648881 6:146441069-146441091 ACAGAGAGAAAGAGAGAAAGTGG + Intergenic
1016881571 6:148917050-148917072 AAGGAGTGAAGAAAGGGAAGAGG + Intronic
1017024287 6:150167922-150167944 ACGGAGACATGGAGAGAAAGGGG - Intronic
1017024298 6:150167963-150167985 GAGGAGAGAAGGAGAGAAAGAGG - Intronic
1017747866 6:157462804-157462826 AGGCAGTGAAGGGCAGGAAGAGG - Intronic
1017800225 6:157888947-157888969 ACGGAGAGAGGGAAAAGAAGAGG + Intronic
1017923189 6:158888681-158888703 ACGGAGTGAAGGTGAGGACAAGG + Intronic
1018266923 6:162035125-162035147 ACAGAGAGAAAGAGAGGAAAGGG + Intronic
1018576672 6:165266827-165266849 ACTGAGTGGAGGAAAGAAAGGGG - Intergenic
1018591823 6:165434238-165434260 AGGGAGGGAAGGAGAGAAGGAGG - Intronic
1018650187 6:165986546-165986568 ACTGAGAGAGGGAGAGGGAGAGG - Intronic
1018914047 6:168121876-168121898 CAGGAGGGAAGGAGAGAAAGAGG + Intergenic
1018933427 6:168257492-168257514 ACGGAGAGAGAGAGAGGCAGAGG - Intergenic
1018986000 6:168637825-168637847 CCGTAGGGAAGGGGAGGAAGAGG - Intronic
1019183015 6:170204093-170204115 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
1019195148 6:170276954-170276976 CCGGAGTGATGGAGGGGAAAGGG - Intergenic
1019309736 7:354127-354149 ACGGAGTGAAGGACAGGACCCGG - Intergenic
1019414095 7:919527-919549 AGGGAGGGAAGGAGAGAGAGAGG + Intronic
1019416731 7:931096-931118 ACGGAGGGACGGAGAGACAGAGG + Intronic
1019534828 7:1523461-1523483 AGGGAGTGCTGGAGACGAAGGGG + Intergenic
1019561919 7:1663748-1663770 AGGGAGAGAGAGAGAGGAAGAGG + Intergenic
1019588999 7:1819699-1819721 ACGGAGTGAGGGAGGGGTGGGGG + Intronic
1019691107 7:2413214-2413236 ACGGAGGGACTGGGAGGAAGAGG - Intronic
1020739090 7:11990518-11990540 AGGGAGAAAAGGAGAGGCAGTGG - Intergenic
1020793956 7:12660269-12660291 ACGGAGTGAGGGTGAGGACAGGG - Intergenic
1021133015 7:16934060-16934082 AGGTAGTGGAGCAGAGGAAGTGG - Intergenic
1021295917 7:18905940-18905962 AAGGAATGAAGGAAAGAAAGAGG - Intronic
1021329036 7:19311874-19311896 ACAGAGTGAAGGAGAGCACTGGG - Intergenic
1021851600 7:24814124-24814146 AGGGAGTGAATGACAGGATGGGG + Intronic
1022149475 7:27586396-27586418 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1022213387 7:28233971-28233993 AGGGAGGGAAGGAGAGAAGGAGG - Intergenic
1022235856 7:28459570-28459592 AAGGAGGGAAGTAGAGGGAGAGG - Intronic
1022391658 7:29949361-29949383 AAAGAGTGAAGGAAAGAAAGGGG - Intronic
1022473356 7:30694950-30694972 AAGGAAGGAAGGGGAGGAAGAGG + Intronic
1022758289 7:33318729-33318751 GGGAAGGGAAGGAGAGGAAGGGG - Intronic
1023134487 7:37037629-37037651 ACAGAGTAGAAGAGAGGAAGGGG + Intronic
1023174184 7:37419662-37419684 ACTGACTGAAGCAGAGAAAGAGG + Intronic
1023507361 7:40914139-40914161 AGGGACTGAAAGAGGGGAAGGGG - Intergenic
1023757253 7:43431419-43431441 ATGGAATGTGGGAGAGGAAGAGG - Intronic
1024171372 7:46791188-46791210 AAGGAGGGAAGGAGAGGAGGGGG + Intergenic
1024271834 7:47648383-47648405 AGGGAGTGAAGGAGAGGGGACGG + Intergenic
1024920090 7:54546055-54546077 AGAGAGGGAAGGAGAGGAAAAGG + Intronic
1025117212 7:56268476-56268498 GAGGAGGGAAGGAGAGGAGGAGG - Intergenic
1025117217 7:56268492-56268514 GAGGAGGGAAGGAGAGGAGGAGG - Intergenic
1025126282 7:56347609-56347631 AGAGAGAGAAGGAGAGAAAGAGG - Intergenic
1025147059 7:56514233-56514255 ACGGAGGGAAGGAGGGAAGGAGG - Intergenic
1025231710 7:57207132-57207154 AGGGAGGGAAGGAGAGGCAAGGG - Intergenic
1025945086 7:66099194-66099216 AAGGAGTGGAGGAGAGGAGGCGG + Intronic
1026205585 7:68254856-68254878 AAGGAGAAAAGAAGAGGAAGAGG - Intergenic
1026238022 7:68545753-68545775 AGGGAGAGAAGGAGGGGGAGGGG - Intergenic
1026305249 7:69134746-69134768 AGGGAGGGGGGGAGAGGAAGAGG - Intergenic
1026769672 7:73187521-73187543 AAGGAGGGAAAGAGAGAAAGAGG - Intergenic
1026789760 7:73324061-73324083 AAGGAGAGAGGGAGAGGGAGAGG + Intronic
1026837560 7:73648501-73648523 AGAGAGGGAAAGAGAGGAAGGGG - Intergenic
1026880713 7:73905091-73905113 ACGGGGAGAAGGAAAGGGAGGGG + Intergenic
1027010541 7:74740907-74740929 AAGGAGGGAAAGAGAGAAAGAGG - Intronic
1027077501 7:75205137-75205159 AAGGAGGGAAAGAGAGAAAGAGG + Intergenic
1027159763 7:75793768-75793790 AGGGAGAGAGGGAGGGGAAGGGG + Intergenic
1027254215 7:76420154-76420176 GAGGAGGGAAGAAGAGGAAGAGG - Intronic
1027486752 7:78771139-78771161 AGGGAGAGAGGGAGAGGCAGAGG - Intronic
1028122990 7:87078259-87078281 AGGGAAGGAAGGAGAGGGAGAGG + Intergenic
1028636755 7:92997877-92997899 AAGGAGTGAAGGAGGGAAGGAGG - Intergenic
1029141670 7:98415166-98415188 AAGGAATGAAGGAGAGGGAGGGG + Intergenic
1029187276 7:98748230-98748252 AGGGAGGGAGGGAGAGAAAGAGG + Intergenic
1029477730 7:100794936-100794958 AAGGAGGGAAGGAGAGAAGGAGG + Intronic
1029542033 7:101189306-101189328 AAAGAGAGAAAGAGAGGAAGGGG + Intergenic
1029654336 7:101914411-101914433 ACGGAGGGAGGGAGGGAAAGAGG - Intronic
1029931928 7:104381547-104381569 AGGGAGTGAGGGAGGGAAAGAGG - Intronic
1030069408 7:105685972-105685994 AGGGGAAGAAGGAGAGGAAGTGG + Intronic
1030162024 7:106518647-106518669 AAGGAGAGAAGGAGAGGAGAGGG - Intergenic
1030166764 7:106562990-106563012 AGGGAGTGAGGGAGAGAGAGAGG + Intergenic
1030380012 7:108800856-108800878 AGGGAGTGGAGGAGAGGAGGAGG - Intergenic
1030386796 7:108875770-108875792 AGGGTGTGATGGAGAGAAAGTGG - Intergenic
1030511648 7:110490148-110490170 ATGGAGTGAAGGAAAACAAGTGG + Intergenic
1030551366 7:110964746-110964768 AGAGAGAGAAGGAGAGAAAGAGG - Intronic
1030595596 7:111535319-111535341 AGGGAGGGAAGGAAAGAAAGAGG + Intronic
1030601958 7:111602875-111602897 ATGGGGTGAAGGAGAGGGGGAGG + Intergenic
1031782493 7:125986010-125986032 AAGGAGTGAATGATAAGAAGTGG + Intergenic
1031993016 7:128210146-128210168 AAGGAGAGAAGGAGAGAAGGAGG + Intergenic
1031993020 7:128210154-128210176 AAGGAGAGAAGGAGGGGAGGTGG + Intergenic
1032326561 7:130934614-130934636 AGGGAGAGAGGGAGAGGAAGAGG + Intergenic
1032497449 7:132373338-132373360 AGGAAGGGAAGGAAAGGAAGAGG + Intronic
1032573519 7:133027443-133027465 AGGGAGGGGGGGAGAGGAAGAGG + Intronic
1032985967 7:137337719-137337741 AGGGAGTGAAGGAAAGAGAGTGG + Intronic
1033047842 7:137978691-137978713 CCTGGGTGAATGAGAGGAAGGGG + Intronic
1033084478 7:138329736-138329758 ACGGAGTGAGGGTGAGGACAGGG - Intergenic
1034174856 7:149091623-149091645 AAGGAGAGAGGGCGAGGAAGGGG + Intergenic
1034189055 7:149199640-149199662 AGGGAGGGAAGGAGAGAAAATGG - Intronic
1034552804 7:151832221-151832243 GAGGAGGGAAGGAGAGGAGGAGG + Intronic
1034621930 7:152463580-152463602 ATGGAAAAAAGGAGAGGAAGAGG + Intergenic
1034635731 7:152565895-152565917 AAGGAGTGAATGAGAGGCAACGG - Intergenic
1035043990 7:155952237-155952259 ACTGAGAGAAGCAGAGGAGGTGG - Intergenic
1035708153 8:1692505-1692527 GGGGAGTGGAGGACAGGAAGAGG + Intronic
1036154089 8:6325809-6325831 AATGAGAGAAGGAGAGGCAGAGG + Intergenic
1036254039 8:7189932-7189954 ATGGGGTGAAGGAAAGGGAGGGG + Intergenic
1036285433 8:7441031-7441053 AAGCAGTGAAGGAGAGAACGAGG + Intergenic
1036336041 8:7870498-7870520 AAGCAGTGAAGGAGAGAAGGAGG - Intergenic
1036363453 8:8097547-8097569 ATGGGGTGAAGGAAAGGGAGGGG - Intergenic
1036472028 8:9060724-9060746 ACGATGTGAAGGAGAGAAACTGG + Intronic
1036895099 8:12627622-12627644 ATGGGGTGAAGGAAAGGGAGGGG + Intergenic
1037094072 8:14962068-14962090 ACAGAAAGAAGGACAGGAAGGGG + Intronic
1037189970 8:16112821-16112843 AGAGAGAGAAAGAGAGGAAGAGG - Intronic
1037585598 8:20273909-20273931 GGGGAGGGGAGGAGAGGAAGTGG - Intronic
1037691254 8:21183339-21183361 AGGGAGAGGAGGAGAGGAAGGGG - Intergenic
1037774390 8:21823332-21823354 AAGGAGGGAAGGAGAGGAGGAGG - Intergenic
1037774398 8:21823356-21823378 AGGAAGTGAAGGAGAGGAGAAGG - Intergenic
1037808571 8:22072354-22072376 TCGGAGGGGAGCAGAGGAAGAGG + Exonic
1037933079 8:22895362-22895384 ACAGAGTGAAGGAGGGTATGTGG - Intronic
1038040326 8:23718665-23718687 GTGGAGTGAATGAGGGGAAGAGG + Intergenic
1038542661 8:28402340-28402362 AGGGAGAGAAGGAGGGGAGGAGG + Intronic
1038735686 8:30167014-30167036 ACAGAAAGAAGGAGAGGAAAGGG + Intronic
1039097793 8:33905150-33905172 AAGGAGAGAAGGAGAGGGAAAGG - Intergenic
1039125038 8:34191802-34191824 ACGGAGGGAGGGGAAGGAAGGGG - Intergenic
1039396766 8:37232572-37232594 AGGGAGTGAAGGCGAGGAGGTGG - Intergenic
1039416763 8:37401850-37401872 ACAGAGAGAAGGAGGAGAAGAGG - Intergenic
1039673336 8:39629623-39629645 AGTGAGTGAAGGAGGGGTAGAGG - Intronic
1039877023 8:41595763-41595785 ACGGAGTCAAGGAGGGAGAGAGG - Intronic
1040562023 8:48531411-48531433 ACTGAGTGCAGGGGAGGATGGGG - Intergenic
1041040237 8:53839420-53839442 ACTGACTGAAGGACAGGAGGAGG - Intronic
1041093089 8:54322001-54322023 AAGGAGGGAGGGAGAGAAAGAGG + Intergenic
1041462256 8:58124090-58124112 ACCTAGTGAAGGAGACAAAGTGG + Intronic
1041818416 8:62001242-62001264 AGGGAGTGAAGGGGAAGGAGAGG - Intergenic
1041897882 8:62947248-62947270 CCTCAGTGAAGGAGGGGAAGGGG - Intronic
1042059639 8:64802632-64802654 AGGGAGTGGAGGGGAGGAAGAGG + Intergenic
1042508697 8:69589200-69589222 ACGGGGTAAAGGAGAGGAGTGGG - Intronic
1042697685 8:71574753-71574775 AAGAAGAGAAGGAAAGGAAGGGG - Intronic
1043037742 8:75218969-75218991 AGGGAGGGAAGGAGAGAAGGGGG + Intergenic
1043095828 8:75970756-75970778 ATGGAGTTAAGCAGAGGAACAGG - Intergenic
1043645815 8:82517296-82517318 ATGGAGTGATGGAGAGGCATAGG + Intergenic
1044555233 8:93555946-93555968 AGAGAGAGAAAGAGAGGAAGGGG - Intergenic
1045192912 8:99900889-99900911 AGGGAGAAAAGGAGAGGCAGAGG - Intergenic
1045517202 8:102870302-102870324 ACAGAGAGAAAGAGAGTAAGAGG - Intronic
1045602412 8:103732874-103732896 AAGGAGTGAAGGCTTGGAAGTGG + Intronic
1045663748 8:104465303-104465325 AGGGAGTGATGGAGAGAAGGAGG + Intronic
1046110370 8:109715978-109716000 ATGGGGTGGAGGAGAGAAAGGGG - Intergenic
1046829905 8:118733203-118733225 AGGGAGGGATGGAGAGGAAAGGG - Intergenic
1046890364 8:119415888-119415910 AGGGAGGAAAGGAGAGAAAGAGG - Intergenic
1047054896 8:121153041-121153063 ACAGTGTGAAGGAGAGGAGGAGG - Intergenic
1047232907 8:123012457-123012479 AGGGAGAGAGGGAGAGAAAGAGG + Intergenic
1047312602 8:123705195-123705217 AAGGAATGAAGAAGAGGAACAGG - Intronic
1047449532 8:124952523-124952545 AGGGAGTGAAGGGAAGGAGGTGG - Intergenic
1047518677 8:125577749-125577771 AAGGAAGGAAGGAAAGGAAGGGG - Intergenic
1047895291 8:129359858-129359880 AGAGAATGAAGGAGAGGGAGAGG + Intergenic
1048191583 8:132294342-132294364 ATGGAGTGAATCAGAGGCAGGGG + Intronic
1048578540 8:135711751-135711773 AGGGAGGGAAGGAGGGGAGGAGG + Intergenic
1048588885 8:135802806-135802828 AGGGAGGGAAGGAGAGAAGGAGG - Intergenic
1048672676 8:136740571-136740593 AGGGAGGGGAGGAGAAGAAGAGG + Intergenic
1048985247 8:139731490-139731512 AGGGAGTGAGGGAGAGGTTGGGG + Intronic
1049177640 8:141203495-141203517 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049454617 8:142680659-142680681 AAGGAGGAAGGGAGAGGAAGGGG + Intronic
1049937538 9:514071-514093 AAGGAGGGAAGGAGAGGAGGAGG - Intronic
1050041348 9:1496968-1496990 ATGCAGAGAGGGAGAGGAAGGGG - Intergenic
1050357764 9:4799063-4799085 AAGGAGAGAAGGAGGGGGAGAGG - Intronic
1050913392 9:11102193-11102215 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
1051256984 9:15223973-15223995 AAGGAGTCAAAGAGAGGAAGAGG - Intronic
1051287869 9:15514297-15514319 ATTGAGTGAATGAGAGGGAGGGG + Intergenic
1051572685 9:18578302-18578324 AGGGAGAGAGGGAGAGAAAGGGG - Intronic
1051762092 9:20478829-20478851 AAGGAGAGAAGGAGAGGAAGGGG + Intronic
1051943030 9:22531357-22531379 AGGGAGTGAGGGAGATGTAGAGG + Intergenic
1052427552 9:28325055-28325077 AGGGAGAGAAGGAGAGAGAGAGG - Intronic
1052695554 9:31872916-31872938 AAGGAAGGAAGGGGAGGAAGAGG - Intergenic
1053329236 9:37188646-37188668 AGGGAGGGGAGGGGAGGAAGGGG - Intronic
1053817452 9:41927520-41927542 AGGAAGGGAAGGAGAGAAAGAGG + Intronic
1054450660 9:65401987-65402009 AAGGAGGGAGGGAGGGGAAGGGG + Intergenic
1054735446 9:68745605-68745627 ATGGAGGGCAGGAGAGGAAGAGG - Intronic
1054737064 9:68764760-68764782 ACAGAATGAAGGTGAGGACGAGG - Intronic
1055360397 9:75483570-75483592 ATACAGTGGAGGAGAGGAAGGGG - Intergenic
1055515706 9:77031141-77031163 AGGGAGGGAGGGAGGGGAAGAGG - Intergenic
1055730269 9:79273793-79273815 AAAGAGAGAAGGAGAGAAAGAGG + Intergenic
1055741009 9:79389407-79389429 TGGCAGTAAAGGAGAGGAAGGGG + Intergenic
1055769418 9:79701618-79701640 AAGGAGCAAAGGTGAGGAAGGGG + Intronic
1056074023 9:83020159-83020181 TAGGAGTCAAGGACAGGAAGAGG + Intronic
1056241504 9:84652250-84652272 ACAGAGTAAAGGAGAGAGAGAGG - Intergenic
1056244644 9:84682148-84682170 AGTGAATGAAGGAGAGGAAAAGG - Intronic
1056277099 9:85004061-85004083 AAGGAGAGAGAGAGAGGAAGAGG + Intronic
1056729223 9:89150360-89150382 ACTGAGTGTGGGAGAGGATGGGG - Intronic
1056833407 9:89934553-89934575 AGGGAGGGAAGGAGAGGGAGAGG + Intergenic
1057123460 9:92598271-92598293 AAGGAGTGAAGGAGGGGAGAAGG + Intronic
1057624182 9:96663035-96663057 ACAGAGTGAAAGAGAGTTAGAGG + Intergenic
1057928130 9:99170808-99170830 AGGGAGGGATGGAGAGGAGGGGG + Intergenic
1057938629 9:99261184-99261206 AAGAAGTGAAGGTGGGGAAGGGG + Intergenic
1058120767 9:101136128-101136150 AAGGAGGGAAGAAGAGGAGGAGG - Intronic
1058262818 9:102857850-102857872 ATGGAGAGGAGGAGAGAAAGAGG - Intergenic
1058452826 9:105113083-105113105 AGAAAGAGAAGGAGAGGAAGAGG + Intergenic
1059382701 9:113939769-113939791 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1059410611 9:114130002-114130024 AAGTAGTGAGGGAGAGGAAAAGG + Intergenic
1059499321 9:114737532-114737554 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1059542429 9:115144118-115144140 AGGGAGGGAAGGAGAGGGAAAGG - Intronic
1059592755 9:115679869-115679891 AGGAGGAGAAGGAGAGGAAGAGG - Intergenic
1059718236 9:116933403-116933425 CCGGAGTGAAGGTGAGTATGAGG + Intronic
1059841480 9:118222472-118222494 ATGGAGTGAAGCAAGGGAAGAGG + Intergenic
1060761018 9:126248913-126248935 AGGGAGGGAAGGAGAGATAGGGG - Intergenic
1061207889 9:129174964-129174986 TGGGAGGGAAGGAGAGGGAGAGG + Intergenic
1061246062 9:129401780-129401802 AGGGAGAGAAGGAGGGAAAGAGG - Intergenic
1061865671 9:133490787-133490809 AGGGGGGGAAGGTGAGGAAGAGG + Intergenic
1062443062 9:136579647-136579669 ACTGAGTGAAGGAGAGGTAGGGG - Intergenic
1062449097 9:136608133-136608155 AGGGAGGGAAGGAGAGAAGGAGG + Intergenic
1062449114 9:136608179-136608201 AGGGAGGGAAGGAGAGAAGGAGG + Intergenic
1203738976 Un_GL000216v2:162241-162263 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1185492504 X:528657-528679 AGGGAGGGAAGGGAAGGAAGAGG - Intergenic
1185499130 X:584276-584298 AGGGAGAGGAGGAGGGGAAGGGG + Intergenic
1185499158 X:584376-584398 AGGGAGAGGAGGAGGGGAAGGGG + Intergenic
1185524956 X:770442-770464 AGGGAGAGAAGGACAGAAAGAGG + Intergenic
1185586345 X:1244547-1244569 AGGGAGGGAAAGAGAGGGAGGGG + Intergenic
1185708417 X:2282393-2282415 ACAGAGAGAAAGAGAGAAAGGGG + Intronic
1185834091 X:3329067-3329089 AAGGAAGGAAGGAGAGGAGGAGG + Intronic
1186047311 X:5550427-5550449 AGGGAGAGAGAGAGAGGAAGAGG - Intergenic
1186172031 X:6887746-6887768 ATGGAGTGAAGGTGAAGATGTGG - Intergenic
1186246700 X:7622758-7622780 AGGGATGGAAGGAGAGGAGGAGG - Intergenic
1186264608 X:7818684-7818706 AGGGAGGGAAGAGGAGGAAGGGG + Intergenic
1186489410 X:9959726-9959748 ACGGAGGGAAGGAGAGAGTGAGG - Intergenic
1186997953 X:15143780-15143802 ATGGAATGAAGGGGTGGAAGGGG - Intergenic
1187480206 X:19648364-19648386 AAGGAGGGAAGGAGGGCAAGAGG + Intronic
1188400051 X:29733034-29733056 AGGGAGGGAGGCAGAGGAAGAGG + Intronic
1189063138 X:37776133-37776155 ATGGAGGGAAGGAAAGGGAGTGG + Intronic
1189110529 X:38285887-38285909 AGAGGGGGAAGGAGAGGAAGAGG - Exonic
1189363862 X:40373409-40373431 AAGTAGTGAAGGGAAGGAAGGGG - Intergenic
1189374994 X:40459716-40459738 AGGGAGGGAAGGAGGGGAGGCGG + Intergenic
1189747196 X:44181393-44181415 ATGGCGTGAAGAAGAGAAAGTGG + Intronic
1189937358 X:46083359-46083381 ATGGAGTCAAGAAGATGAAGAGG - Intergenic
1189988874 X:46576189-46576211 AGGGAGAGGAGGAGGGGAAGGGG - Intronic
1190040676 X:47069121-47069143 AGGGAGTAAAAGAGAGGGAGAGG - Intergenic
1190124901 X:47695641-47695663 GAGGAGAGGAGGAGAGGAAGAGG - Intergenic
1190259669 X:48790010-48790032 ACGGGGAGAATAAGAGGAAGTGG + Intronic
1190480438 X:50871583-50871605 AAGTAGGGAAGGAGGGGAAGAGG - Intergenic
1190557549 X:51651374-51651396 ACGGAGTGTTGGTAAGGAAGTGG - Intergenic
1191014429 X:55793228-55793250 ACGGAGTGAGGGTGAGGACAGGG + Intergenic
1191110041 X:56797135-56797157 AAGGAGGGAAGGGGAAGAAGAGG - Intergenic
1191110049 X:56797173-56797195 AAGGAGAGAAGAAGAGGAAGAGG - Intergenic
1192800460 X:74460397-74460419 CCTGAGTGAAAGAGAGGATGAGG - Intronic
1193333544 X:80261981-80262003 AGAGAGTGAAGGAGGGGAAAGGG - Intergenic
1193386557 X:80879483-80879505 GCGGAGAGCAGGAGAAGAAGAGG + Intergenic
1193536819 X:82727246-82727268 ACGGAGTGAGGGTGAGGACAGGG - Intergenic
1193667839 X:84345300-84345322 ATAGTGGGAAGGAGAGGAAGAGG - Intronic
1194348499 X:92796005-92796027 AGGGAGGGAAGGAGAGGGCGAGG + Intergenic
1194533752 X:95080222-95080244 AAGGAGGGAAGGAAAGGAAATGG + Intergenic
1194653948 X:96548660-96548682 AGGAAGAGAAAGAGAGGAAGGGG + Intergenic
1194755154 X:97730731-97730753 AGGGAGGGAAGGAGAGAGAGGGG - Intergenic
1194982549 X:100455015-100455037 AAGGAGGGAAGGAGAGAAGGAGG + Intergenic
1194987987 X:100511999-100512021 AGGGAGAGAAGGTGAGGAAGTGG - Intergenic
1195299110 X:103509555-103509577 AAGGAGGGAGGGAGAGGAAGAGG - Intronic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1196031271 X:111097129-111097151 CAGGAGAGAAGGAGAGGCAGTGG - Intronic
1196441964 X:115726742-115726764 AGAGAGAGCAGGAGAGGAAGTGG - Intergenic
1196442625 X:115729704-115729726 AGAGAGAGCAGGAGAGGAAGTGG - Intergenic
1196442933 X:115731201-115731223 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196443598 X:115734169-115734191 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196445924 X:115846096-115846118 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196446595 X:115849077-115849099 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196447263 X:115852058-115852080 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196447934 X:115855033-115855055 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196448603 X:115858020-115858042 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196449274 X:115861011-115861033 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196449943 X:115863998-115864020 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196450613 X:115866973-115866995 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196451284 X:115869962-115869984 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196451955 X:115872945-115872967 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196452625 X:115875924-115875946 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196453295 X:115878893-115878915 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196453965 X:115881902-115881924 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196454631 X:115884907-115884929 AGAGAGAGCAGGAGAGGAAGTGG + Intergenic
1196652306 X:118180383-118180405 CCTGAATGAGGGAGAGGAAGAGG + Intergenic
1196814274 X:119652739-119652761 AGGGAATGAGGGAGAGGATGAGG + Intronic
1196828414 X:119758519-119758541 AGGGAGCAAAGGAGAGGAGGAGG - Intergenic
1196906741 X:120444458-120444480 AGGGAGATAAGGAGAGTAAGTGG - Intronic
1197226463 X:123960733-123960755 AGGGTGTAAAGAAGAGGAAGGGG + Exonic
1197701057 X:129599977-129599999 ACAAAGTGAAGGAGAGGAAAGGG - Intergenic
1197950424 X:131890103-131890125 ACTGAGTGAGAGAGAGGAAATGG - Intergenic
1198745411 X:139885132-139885154 AGGGAGGGAAGGACAGGAATTGG - Intronic
1199086778 X:143636363-143636385 ACGGGGAGAAGGAGAGGAAATGG + Intergenic
1199549377 X:149042021-149042043 AGGGAGAGCAGGAGAGGGAGAGG - Intergenic
1199596333 X:149509219-149509241 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
1199599839 X:149535385-149535407 AGGAGGAGAAGGAGAGGAAGGGG - Intergenic
1199811074 X:151349385-151349407 ACAGAGAGAGGGAGAGGGAGAGG + Intergenic
1199814504 X:151385999-151386021 AGGTAGAGAAGGAGAGGAAACGG - Intergenic
1201146116 Y:11066549-11066571 AGGAAGTGAGGGAGAGGGAGGGG + Intergenic
1201146170 Y:11066710-11066732 AGGGAGGGAGGGAGAGGGAGAGG + Intergenic
1201146514 Y:11067815-11067837 AGGGAGAGAAGGGGAGGGAGAGG + Intergenic
1201146577 Y:11068001-11068023 ATGGAGGGAGGGAGAGGGAGAGG + Intergenic
1201179454 Y:11332015-11332037 CCGGAGAGACGAAGAGGAAGGGG - Intergenic
1201256485 Y:12112824-12112846 AGGGAGAGAAAGAGAGGTAGGGG - Intergenic
1201328988 Y:12798074-12798096 AGGGAGAGAGGGAGGGGAAGGGG - Intronic
1201741149 Y:17325696-17325718 AGGGAGGGAAAGAGAGAAAGAGG + Intergenic
1202088937 Y:21168438-21168460 AGGGAGAGAGGGAGAGAAAGAGG + Intergenic