ID: 1013588953

View in Genome Browser
Species Human (GRCh38)
Location 6:111604363-111604385
Sequence CTGGACCAGTCACTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013588953_1013588960 19 Left 1013588953 6:111604363-111604385 CCCACACACAGTGACTGGTCCAG 0: 1
1: 0
2: 2
3: 25
4: 255
Right 1013588960 6:111604405-111604427 TCCAGCTACAGCAGTAACTCTGG 0: 1
1: 0
2: 1
3: 13
4: 152
1013588953_1013588962 26 Left 1013588953 6:111604363-111604385 CCCACACACAGTGACTGGTCCAG 0: 1
1: 0
2: 2
3: 25
4: 255
Right 1013588962 6:111604412-111604434 ACAGCAGTAACTCTGGCTTCTGG No data
1013588953_1013588958 -4 Left 1013588953 6:111604363-111604385 CCCACACACAGTGACTGGTCCAG 0: 1
1: 0
2: 2
3: 25
4: 255
Right 1013588958 6:111604382-111604404 CCAGCTGAGGAGTGGTTTCCAGG 0: 1
1: 0
2: 4
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013588953 Original CRISPR CTGGACCAGTCACTGTGTGT GGG (reversed) Intronic
900141429 1:1140802-1140824 CTGGAGCAGTGACGGGGTGTTGG - Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901502208 1:9659723-9659745 CTGGACATTCCACTGTGTGTAGG + Intronic
902340193 1:15778102-15778124 CAGGGCCAGTCACTGTGGCTGGG + Intronic
902408421 1:16199141-16199163 CTGGACCAGTGACGGTGAGGGGG - Exonic
902620672 1:17648981-17649003 CTGTGCCAGCCACTGTGGGTTGG + Intronic
902907946 1:19572937-19572959 TTGGACCAGTCATTGGATGTAGG + Intergenic
902981205 1:20124677-20124699 ATGGATGAGTCACTGTGTCTTGG + Intergenic
903625568 1:24727693-24727715 AAGGACCAGACACTGTGGGTTGG + Intergenic
904236310 1:29119609-29119631 CTGGGCCCATCAGTGTGTGTTGG + Exonic
904294853 1:29513567-29513589 CTGAACCAGTCACTGTGGCTGGG + Intergenic
904449176 1:30600102-30600124 CTGGAGCAGACACTGTGTCCAGG + Intergenic
906773583 1:48507846-48507868 CTGGACCTGTCATTGTTTCTAGG + Intergenic
907285903 1:53379416-53379438 CCGGGCCTGTTACTGTGTGTGGG + Intergenic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
908896320 1:68904443-68904465 CTGGAGCAGAAAATGTGTGTGGG - Intergenic
910323144 1:85972729-85972751 CTGGACCAGTCATTTTTTCTGGG - Intronic
912356815 1:109061025-109061047 CTGGACCAGTCACTATGGCCAGG - Intergenic
913061992 1:115216968-115216990 CAGGATCAGTCTCTGTGTGCTGG - Intergenic
915117462 1:153609687-153609709 CTGGACCAGGCAATGTGGGCTGG - Intronic
918621376 1:186609734-186609756 ATAGACCAGTCAGTGTGGGTGGG + Intergenic
920667335 1:207972605-207972627 CTCGTCCAGTCACTGTGCTTGGG + Intergenic
922090888 1:222394083-222394105 GTGGATCAGTCACTGGATGTGGG - Intergenic
922295990 1:224250261-224250283 CTGGACAAAACACTGTTTGTGGG - Exonic
923725380 1:236501090-236501112 TTGGGCCAGTCACTGAGTTTTGG + Intergenic
924328374 1:242918589-242918611 TTCGATCAGGCACTGTGTGTTGG - Intergenic
1063623050 10:7666846-7666868 CTGGGGCTGTCCCTGTGTGTGGG - Exonic
1063917455 10:10897967-10897989 CTGAACCAGTCACTGTTTCTGGG - Intergenic
1064027744 10:11862009-11862031 CTGGGCCTGTCAGTCTGTGTTGG - Intronic
1064121729 10:12624884-12624906 CTGGGCCACCCATTGTGTGTAGG - Intronic
1066235913 10:33484287-33484309 CTGGACCTGCCACAGTGTGAAGG - Intergenic
1067371418 10:45686926-45686948 CTGTTCCAGTCACTTTCTGTAGG + Intergenic
1067388365 10:45839224-45839246 CTGTTCCAGTCACTTTCTGTAGG - Intronic
1067417704 10:46117734-46117756 CTGTTCCAGTCACTTTCTGTAGG + Intergenic
1067422215 10:46161966-46161988 CTGTACCAATCACTGAGTTTTGG + Intergenic
1067503116 10:46824621-46824643 CTGTTCCAGTCACTTTCTGTAGG + Intergenic
1067507521 10:46868063-46868085 CTGTACCAATCACTGAGTTTTGG + Intergenic
1068106526 10:52623982-52624004 CTTGACCAGTTCCTGTGTTTAGG + Intergenic
1069581470 10:69569717-69569739 GAGGACCAGTCTGTGTGTGTTGG + Intergenic
1070108575 10:73460773-73460795 CTGGAGCAGTCCCTGGCTGTGGG - Intronic
1070135197 10:73687906-73687928 CTGTTCCAGTCACTTTCTGTAGG - Intronic
1070541516 10:77418612-77418634 CTGGACCAGCCACTTTGTCAAGG - Intronic
1070673819 10:78398227-78398249 GTGGACCAGTCAGTGTCTGAGGG - Intergenic
1070859647 10:79640790-79640812 CTGTACCAATCACTGAGTTTTGG + Intergenic
1070977631 10:80617945-80617967 CTGGACCAGTCACTGTGGTCAGG + Intronic
1071841286 10:89474351-89474373 CTGAACCAGGCAGTGTGTTTGGG - Intronic
1073890719 10:108097357-108097379 CTGGGGCAGTCACTGGGAGTAGG + Intergenic
1075178287 10:120186013-120186035 CTGGACCAATCACTGTTTCCAGG + Intergenic
1076305163 10:129461102-129461124 CTGGACCAATCACGGTGGGCAGG - Intergenic
1076415972 10:130288834-130288856 CTGAACAAGGCAGTGTGTGTTGG - Intergenic
1077503559 11:2920008-2920030 CTGGACCAGACCCTGGGTGGTGG + Intronic
1077527769 11:3077987-3078009 CTTGTCCAGTCACTGAGTTTTGG + Intergenic
1078144323 11:8712713-8712735 GTGGACCAGGCGCTGTGTGTGGG + Exonic
1081815549 11:45938143-45938165 CAGGACCAGGTACTGTGGGTGGG - Exonic
1082828655 11:57599059-57599081 CTGGACTAGTTAATATGTGTCGG + Intronic
1083853386 11:65380348-65380370 CTGGCCCAGTGCCTGTGTGGAGG - Intronic
1084650975 11:70489199-70489221 ATTGACCAGTCACTCTGAGTTGG + Intronic
1084790711 11:71473775-71473797 CTGGAACATCCATTGTGTGTGGG - Intronic
1086385413 11:86302308-86302330 CTGGCCCAGTCACTATGTAGTGG + Exonic
1089470285 11:118715205-118715227 CGGGGGCAGTCACTGTGTGCAGG - Intergenic
1090149266 11:124365253-124365275 CTGTGCCACTCACTGGGTGTGGG - Intergenic
1090632207 11:128659580-128659602 CTGAACCAATCACTGTGGTTGGG + Intergenic
1090682387 11:129075716-129075738 ATGGAACAGTCACTGTATCTTGG + Intronic
1090787639 11:130064267-130064289 CTTGGCCAGTCACTGGGTGGGGG - Intergenic
1092125358 12:6071643-6071665 CTCTGCCACTCACTGTGTGTGGG - Intronic
1092247121 12:6869882-6869904 TTGGACAAGTCACTGTCTCTGGG - Intronic
1092450192 12:8594428-8594450 CTGGAGCAGTCACTCGGGGTTGG + Intergenic
1093626119 12:21349976-21349998 CTGTTCCAGTCACTGAATGTTGG - Intronic
1096444287 12:51674750-51674772 CTGTACCAGCCACTGTGTTAAGG + Intronic
1100262954 12:92950049-92950071 CTGGAACAGCCACCTTGTGTTGG - Intergenic
1101812520 12:108120151-108120173 CTGGACCAATCACTGTGGCCAGG + Intergenic
1102635916 12:114323715-114323737 ATGGACCAGTCATTGGATGTCGG - Intergenic
1103941398 12:124503268-124503290 CCAGACCTGTCACTGGGTGTGGG - Intronic
1104159113 12:126161655-126161677 CAGGGCAAGTCACTGTTTGTGGG + Intergenic
1104809283 12:131610855-131610877 CTGGAGCTGGAACTGTGTGTAGG - Intergenic
1107114136 13:36728200-36728222 CTGTACCAGGCACTGTGTCAGGG - Intergenic
1110730872 13:78877234-78877256 CTGGAACAGGCACTGGGAGTGGG + Intergenic
1111312096 13:86502313-86502335 ATTGACCAGTCCCTGGGTGTGGG - Intergenic
1111892166 13:94097073-94097095 CTTGAGCACTTACTGTGTGTTGG - Intronic
1112717746 13:102205925-102205947 GTGGACCAGTCACTGGGACTTGG + Intronic
1114429532 14:22648509-22648531 TTGGATCAGTCACTGTGGTTGGG - Intergenic
1115322139 14:32093673-32093695 CTGGAACGGTCACTAGGTGTTGG - Exonic
1115427244 14:33274209-33274231 TTGTACCAATCACTGTGTTTTGG - Intronic
1115594208 14:34893689-34893711 ATGGACCAGACACTGTGCTTAGG - Intergenic
1118007308 14:61575204-61575226 TTGGACCAGTCCCTCTGTTTGGG + Intronic
1118778354 14:68988721-68988743 CTGGACCAGCCACAGAGAGTAGG - Intergenic
1119443459 14:74645359-74645381 CTGAACCAATCACTGTGGCTAGG - Intergenic
1120756998 14:88253978-88254000 CTGGACCAGTCAGGGTGAGGGGG + Intronic
1121083504 14:91127514-91127536 CTGGCCCAGGCCCAGTGTGTTGG - Intronic
1128288264 15:66456697-66456719 CTGGACCATTCACTGTGTCCAGG + Intronic
1128575992 15:68775569-68775591 TTGTACCAGTCACTGTGGTTAGG + Intergenic
1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG + Intergenic
1129811007 15:78509971-78509993 CTGGAGCAATCACTTTGGGTAGG + Intronic
1130104654 15:80920308-80920330 CTGGACCCCTCTCTGTGTGCTGG + Intronic
1131090183 15:89618618-89618640 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131090752 15:89623174-89623196 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131471526 15:92701798-92701820 TTGTACCAGTCACTGAGTTTTGG - Intronic
1133194536 16:4159549-4159571 CTGGGCCAAGGACTGTGTGTAGG + Intergenic
1133483216 16:6192216-6192238 CGGGACCAGTCCTTGGGTGTTGG + Intronic
1134295649 16:12943138-12943160 CTGCACCAGTCACTGTGACGAGG + Intronic
1136008746 16:27348687-27348709 CTGAACCAATCACTGGCTGTGGG + Intronic
1136408886 16:30065232-30065254 CTGGGCCAGTGACAGGGTGTCGG + Intronic
1137699711 16:50488836-50488858 CTGGACCAATCACTGTGGCCAGG + Intergenic
1138316384 16:56073615-56073637 TTGGACGAGTCACTGTGTCCAGG + Intergenic
1138984573 16:62312534-62312556 CTGAACCAATCACTGTGGTTAGG - Intergenic
1139321984 16:66122267-66122289 CTGTTCCAGGCACTGTTTGTAGG + Intergenic
1139676307 16:68526318-68526340 CTGGACTCCTCTCTGTGTGTTGG + Intergenic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1142119706 16:88379881-88379903 CCGGGCCAGTCACTGTGTGAAGG - Intergenic
1143989632 17:10945670-10945692 CTGAACCAGTCATTATGGGTAGG - Intergenic
1145782585 17:27572762-27572784 CTGTGCCTGTCACTGTGGGTGGG + Intronic
1145854600 17:28141871-28141893 CTGGAATAGTCACTGTTTTTTGG - Intronic
1146480157 17:33198553-33198575 CTGGATCAGTCACCATGTGCAGG - Intronic
1146554595 17:33812853-33812875 CTGAACCTCTCACTGGGTGTGGG + Intronic
1149772861 17:59334496-59334518 ATGGCCCAGTCCCTGTGTGCAGG + Intronic
1150347229 17:64413616-64413638 CTTCACCTGTCACTGAGTGTGGG - Intronic
1150475090 17:65468820-65468842 CTGGACAAGTGGCTGAGTGTAGG - Intergenic
1155986821 18:32238820-32238842 CTGCACCTCTCTCTGTGTGTTGG + Intronic
1156373036 18:36488534-36488556 CTGGACTATTCACTGTATGGAGG + Intronic
1158212542 18:55067387-55067409 CTGGACCATTTACTGTCTGCAGG - Intergenic
1158564724 18:58545105-58545127 CTGCACCAGTCATAGTGTGCTGG - Intronic
1159004243 18:62998632-62998654 CTAGACCAGTCACTGTAACTGGG - Intergenic
1159129372 18:64262876-64262898 CTGGACCTGTCATTGTTTTTTGG - Intergenic
1160117099 18:76089753-76089775 CAGGACCAGGCACGGTGTGGAGG + Intergenic
1161835828 19:6645632-6645654 CTGGACCCCTTACTGGGTGTAGG + Intergenic
1162080384 19:8214468-8214490 CTGGAACAGGCATGGTGTGTTGG + Intronic
1165541754 19:36497780-36497802 CTGTACCAGACACTGTGGGAAGG - Intergenic
1166951341 19:46430095-46430117 CTGAACCAATCACTGTGGGAAGG - Intergenic
1167214278 19:48154085-48154107 CTGGGGCAGTGACTGTGTGCAGG - Intronic
1167881084 19:52457909-52457931 CAGCACCAGTCACTGTGAGATGG - Intronic
1168240207 19:55085143-55085165 CTGTACCACTTACTGTGTGCTGG - Intronic
926361026 2:12087252-12087274 TTGTACCAATCACTGTGTTTTGG + Intergenic
926487296 2:13477770-13477792 CTGGACCTGTCACCTTGTATGGG - Intergenic
926772953 2:16394246-16394268 CTGGACCAGCCCCTGCCTGTCGG + Intergenic
926910372 2:17847345-17847367 CTGTAACAGTGACTGTGTCTTGG + Intergenic
927650299 2:24908898-24908920 GTGGAGCAGCCAATGTGTGTCGG - Intronic
929057745 2:37893027-37893049 CTGTAACAGTCACTGAGTCTTGG - Intergenic
931384167 2:61782277-61782299 CTGTGCCAGTCACTGAGTTTTGG - Intergenic
932578478 2:72976995-72977017 CTAGACCAGTCACTGCCCGTGGG - Intronic
934758177 2:96839116-96839138 CAGGGCCAGTCTGTGTGTGTGGG - Exonic
935414182 2:102798165-102798187 CTTGAACACTAACTGTGTGTCGG + Intronic
935591257 2:104847203-104847225 CTGGAGCTGTCACAGTGTGATGG - Intergenic
935813983 2:106829282-106829304 CTGTACCAGTTACTAGGTGTTGG + Intronic
937061733 2:118985060-118985082 CTGGGCCAGGCACTGTGCCTGGG + Intronic
937452171 2:122010687-122010709 CTGGATCAGTCACTGGGTGTGGG + Intergenic
938248150 2:129794734-129794756 CCGGAACATTCACTGTGTGTTGG - Intergenic
939801799 2:146720371-146720393 CTGGAGCAGGCACTGGGAGTGGG - Intergenic
939955816 2:148526974-148526996 ATGGAGAAGTCACTGGGTGTAGG + Intergenic
940386188 2:153075265-153075287 CTGGGTTGGTCACTGTGTGTAGG + Intergenic
941105528 2:161347771-161347793 GTGGAGCACTCACTGTGTGCCGG + Intronic
945247320 2:207730373-207730395 CTGTTCCAGTCACTCTCTGTAGG + Intronic
945516174 2:210765746-210765768 CTGAACCAGTCACTGTGGCAGGG + Intergenic
945862374 2:215138729-215138751 CTAGAGCAGACACTGTGTGCAGG - Intergenic
947528868 2:230896003-230896025 CTGGAGCAGTCATTGGGTGGAGG - Intergenic
948643526 2:239389879-239389901 CTGAACCAGTCACTGTGACCGGG - Intronic
948718693 2:239882647-239882669 CTGGTCCAGGCACTATGTGCTGG + Intergenic
1169490554 20:6067873-6067895 CTGCACATGTTACTGTGTGTTGG - Intergenic
1169772951 20:9221279-9221301 CTGCATCAGTCACTGACTGTGGG + Intronic
1171142622 20:22755999-22756021 CTGAGCCAGTCACTGTTTATTGG + Intergenic
1172956005 20:38759664-38759686 CTGCACCTGTCACTGAGTGGTGG - Intronic
1173034245 20:39393623-39393645 CCAGACCAGTCACTGAATGTGGG - Intergenic
1174786589 20:53438523-53438545 CTGGACCAATCACTGTGGCTAGG + Intronic
1175415316 20:58797077-58797099 CTGGACAGGTTACTGTGGGTGGG - Intergenic
1175832431 20:61973495-61973517 CGGGTCCAGTCAGTCTGTGTGGG - Intronic
1176265801 20:64208754-64208776 TGTGACCAGTCACTGTGGGTGGG - Intronic
1176341179 21:5697385-5697407 CTGTACCAGGCACTGTGGGAAGG + Intergenic
1176473433 21:7129538-7129560 CTGTACCAGGCACTGTGGGAAGG + Intergenic
1176503648 21:7627071-7627093 CTGTACCAGGCACTGTGGGAAGG - Intergenic
1178290402 21:31363066-31363088 CTGGACCAATCACTGTGTACAGG - Intronic
1179167918 21:38949002-38949024 CTGGGCCAATCACAGTGTGTGGG - Intergenic
1180071983 21:45441196-45441218 CAGGAGCAGCCTCTGTGTGTAGG - Intronic
1180855671 22:19043287-19043309 TTGGACCAGATACTGTGTGTTGG - Intronic
1183299369 22:37051534-37051556 CTGGCCAAATCACTGTGTATGGG - Intergenic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
1183630570 22:39030132-39030154 CTGGGCCAGTCACTGTGGGCTGG + Intronic
1183634026 22:39050224-39050246 CTGGGCCAGTCACTGTGGGCTGG + Intronic
1203240444 22_KI270733v1_random:11849-11871 CTGTACCAGGCACTGTGGGAAGG + Intergenic
949505330 3:4722350-4722372 CAGGACCAGTCACTGCGTTCAGG - Intronic
949988252 3:9556203-9556225 ATGAACCAGTCACTGTGTCCAGG - Intergenic
950933152 3:16811376-16811398 CTGGAACACTCACTGTGCTTTGG - Intronic
951628422 3:24692289-24692311 ATTGACCAGTCACTGGATGTAGG - Intergenic
953548142 3:43879458-43879480 TTGACCCAGTCACAGTGTGTGGG - Intergenic
954258368 3:49421742-49421764 CTCCCCCAGTCACTCTGTGTGGG + Intronic
955102705 3:55867309-55867331 CTGTGCTAGGCACTGTGTGTGGG - Intronic
955417725 3:58708299-58708321 CTGAAGCAGTCTCTGGGTGTGGG + Intergenic
955966810 3:64397265-64397287 CAGGACCTCTAACTGTGTGTAGG + Intronic
956374354 3:68598326-68598348 CTGCACCAGTCACTGTGGCTAGG - Intergenic
956767851 3:72499163-72499185 CTGAACCAATCACTGTGGCTAGG - Intergenic
956782366 3:72614092-72614114 CTGAACCAATCACTGTGACTAGG - Intergenic
959356420 3:105335087-105335109 CTGGACCAGTCACTGTGTCAGGG - Intergenic
959503923 3:107137224-107137246 CTGTAACAGTCACTGAGTCTTGG + Intergenic
959874330 3:111364071-111364093 TTGGACTAGTCTCTGTATGTAGG + Intronic
961673342 3:128550189-128550211 CTAGGCCAGTCACTGTGGGATGG - Intergenic
961690918 3:128668962-128668984 GTGTTCCAGTCACTGTGTCTTGG + Intronic
961808621 3:129507535-129507557 CTGGCACAGACACTGTGTGGTGG + Intronic
962944706 3:140156605-140156627 CTGAGCCAGTGACTGAGTGTGGG + Intronic
964130888 3:153285271-153285293 CTCGACCAGTCACTGTGTCCAGG - Intergenic
964558213 3:157964275-157964297 CTGGACCAATCATTGTGGGAAGG + Intergenic
964970541 3:162554073-162554095 CTGGATCTGTCACTGTATGGGGG + Intergenic
965334192 3:167416001-167416023 CTGAACCAATCTCTGTGTTTAGG + Intergenic
966731950 3:183158790-183158812 CTGTACCAGGCACTGGGGGTAGG + Intronic
969129135 4:4978348-4978370 TTGCGCCAGTCACTGTGTTTGGG + Intergenic
969928057 4:10603745-10603767 GTGGCCCAGTCAGTGGGTGTGGG + Intronic
973614458 4:52664705-52664727 CTGAACCAGTCACTCTGGCTGGG - Intergenic
976482257 4:85558128-85558150 CTGGGCCAGTCACTGTTGCTAGG + Intronic
978198332 4:105996019-105996041 CTGGAGCATTCAATGTGTATAGG - Intronic
978324066 4:107531509-107531531 ATGAACCAGTCACTGTGTCATGG - Intergenic
978739414 4:112120160-112120182 CTGGACCAATCACTGTAGCTAGG - Intergenic
979679197 4:123441071-123441093 TTGGACCAATCACTGTGGCTAGG - Intergenic
982135054 4:152267384-152267406 CTGGGCCATTCACTGTGTTCAGG - Intergenic
984181935 4:176494465-176494487 CTGTGCCAGTCACTGAGTTTTGG + Intergenic
985747401 5:1655019-1655041 CTGGAACAGGCTCTGTGTGGAGG - Intergenic
986959252 5:13192941-13192963 CTGAACCAGTCACTGGGGATGGG + Intergenic
987004238 5:13692862-13692884 CTGGACCTGTCTCTGAGTATGGG - Intronic
988367016 5:30313327-30313349 CTGTGCCAGTCACTGAGTTTTGG - Intergenic
994336763 5:98576377-98576399 CTGTACCAGGCACTGTGGGAAGG + Intergenic
994382286 5:99085490-99085512 CTGAACCATTCACTGTGGCTGGG + Intergenic
995015674 5:107306188-107306210 CCAGTCCAGTCACTGGGTGTGGG - Intergenic
995752759 5:115471025-115471047 CTGGATCAGTCCCTTGGTGTTGG - Intergenic
997425968 5:133802859-133802881 CTATACCAGTTACTGTGTTTGGG - Intergenic
997618602 5:135270481-135270503 CTGGAGCAGCCACTGTTTCTGGG + Intronic
998526172 5:142845252-142845274 CTGTACCAGGAACTGTGTCTAGG + Intronic
999207437 5:149859628-149859650 ATGGATCAGTCATTGGGTGTAGG + Exonic
999645518 5:153713331-153713353 CTGGGCCAGTCCCTTTGTGTTGG - Intronic
999740064 5:154543067-154543089 CTGAACCAGTCACTGTGGGAGGG - Intergenic
1000056776 5:157614043-157614065 CTGGGCCAGTCACTGTGACCGGG + Intergenic
1000375367 5:160576110-160576132 CTGAACCAATCACTGTGAATGGG + Intronic
1002437687 5:179242020-179242042 CTGGACCAATCACTGTGCTGAGG - Intronic
1005842063 6:29750063-29750085 CTGGGACAGTCACAGTGTTTAGG - Intergenic
1007408325 6:41647435-41647457 TTGGCCCAGTCACCCTGTGTGGG + Intronic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1007784920 6:44274319-44274341 TTGGACAAGTCACTGAGTTTAGG - Intronic
1007921014 6:45609547-45609569 CTGGAACAGGCACTGAGTGGAGG + Intronic
1010100517 6:72100976-72100998 CTGTACCATTGACTGTATGTGGG + Intronic
1011936118 6:92780117-92780139 CTGGACAACTCTCTGAGTGTTGG + Intergenic
1013588953 6:111604363-111604385 CTGGACCAGTCACTGTGTGTGGG - Intronic
1013784600 6:113765390-113765412 ATGGACCAGTTACTGTGTCCTGG + Intergenic
1014510292 6:122312527-122312549 ATGTGCCAGTCACTGTGTTTAGG - Intergenic
1015273797 6:131363886-131363908 CTGAACCAGTCACTGTTGGAAGG + Intergenic
1015780113 6:136856607-136856629 CTGAACTAATCACTGTGTGTGGG + Intronic
1016748817 6:147610630-147610652 CTGAAACAGTCAGTGTGTGCAGG - Intronic
1017888774 6:158622316-158622338 ATGCCCCAGTCCCTGTGTGTGGG + Intronic
1022158530 7:27684588-27684610 CTGTACCAGTCACTGTGGCAAGG - Intergenic
1024948471 7:54834562-54834584 CTGGACCAGGCACTGGGAGGCGG - Intergenic
1026584047 7:71641798-71641820 CTTGAACACTTACTGTGTGTTGG - Intronic
1029477265 7:100792396-100792418 CTGCACCAGGCACTGCGTGCTGG + Exonic
1030118477 7:106082683-106082705 CTGTAACAGTCACTGAGTCTTGG - Intergenic
1032951236 7:136916101-136916123 CTGGACTATGCACTGTTTGTAGG + Intronic
1033826360 7:145194918-145194940 CTGGACCAGTCATTGGATATAGG + Intergenic
1034895282 7:154872486-154872508 CTGGGCCAGTCTCTGTCTGTGGG + Intronic
1037958972 8:23082221-23082243 CTGGTCCAGTCTCTGGGCGTAGG - Intergenic
1043326677 8:79060793-79060815 CTGGATCAGTTACTGTGTTCAGG + Intergenic
1044806313 8:96011879-96011901 CTGCACCAAGCTCTGTGTGTGGG - Intergenic
1046401743 8:113713507-113713529 CTGGACCAGTCACTGGGTACAGG + Intergenic
1047312040 8:123700130-123700152 CTGGAGCAGCCACTGTGGGGCGG - Intronic
1048332332 8:133479302-133479324 CTGGATCAGACACAGTGTGGAGG + Intronic
1048553229 8:135453394-135453416 CTGGACCAGGCACTGGGGCTGGG + Intergenic
1051190917 9:14511640-14511662 CAAGACCAGTCATAGTGTGTGGG - Intergenic
1051981105 9:23018343-23018365 ATGGTACAGTCACTTTGTGTTGG - Intergenic
1052691377 9:31820671-31820693 CTGGAGCAGGCACTGGGGGTGGG - Intergenic
1054825566 9:69569544-69569566 CTGGACAATTCTTTGTGTGTGGG - Intronic
1055376788 9:75657388-75657410 CTAGACCAGTCACTGGATGTGGG - Intergenic
1057814985 9:98287600-98287622 CTGAACCAATCACTGTGTCCGGG + Intergenic
1057845146 9:98517162-98517184 CTGGGCCAGTCACTGGGTGCAGG - Intronic
1058434803 9:104952438-104952460 CTGGACCATTCAATGTTTATGGG + Intergenic
1059472009 9:114512390-114512412 GTGTGCCAGGCACTGTGTGTGGG + Intergenic
1062415819 9:136449140-136449162 CTGTCCAAGTCAGTGTGTGTCGG + Intronic
1203421888 Un_GL000195v1:608-630 CTGTACCAGGCACTGTGGGAAGG - Intergenic
1186350112 X:8731912-8731934 CTGGACGAGTCGCTGTCTGCCGG - Exonic
1188781165 X:34287249-34287271 AATGACCAGTCACTATGTGTGGG + Intergenic
1189892676 X:45621688-45621710 AAGGACCAGTCACTATGGGTGGG + Intergenic
1190010633 X:46781476-46781498 CTGAACCAATCACTGTGGCTGGG + Intergenic
1190897757 X:54638347-54638369 CTGTATCAGGCACTGTGTGAAGG - Intergenic
1194179770 X:90697339-90697361 CAGGGTCAGTCACTGTGTATGGG - Intergenic
1194820522 X:98500836-98500858 CTGGCACAGACCCTGTGTGTTGG + Intergenic
1195171493 X:102272867-102272889 CTCCACCAGTCACTGAATGTGGG - Intergenic
1195187367 X:102414232-102414254 CTCCACCAGTCACTGAATGTGGG + Intronic
1195353763 X:104018904-104018926 CTGGATCAGGCAGTGTGTATGGG + Intergenic
1198968425 X:142251816-142251838 CTGAACCAATCACTGTGGATAGG + Intergenic
1199838410 X:151617671-151617693 CTGGACCAGTTCCTGTATTTTGG - Intronic
1200526430 Y:4279508-4279530 CAGGATCAGTCACTGTGTATTGG - Intergenic
1201225757 Y:11817546-11817568 TTCGATCAGGCACTGTGTGTTGG - Intergenic
1201416278 Y:13751901-13751923 CTGGACGAGTCGCTGTCTGCCGG + Intergenic