ID: 1013591169

View in Genome Browser
Species Human (GRCh38)
Location 6:111620553-111620575
Sequence CCTTTCTAAGGCATCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013591160_1013591169 -7 Left 1013591160 6:111620537-111620559 CCAGCAGCCTCCCCTGCCTTTCT No data
Right 1013591169 6:111620553-111620575 CCTTTCTAAGGCATCTTGGGAGG No data
1013591159_1013591169 5 Left 1013591159 6:111620525-111620547 CCTGTGGGAAGTCCAGCAGCCTC No data
Right 1013591169 6:111620553-111620575 CCTTTCTAAGGCATCTTGGGAGG No data
1013591157_1013591169 18 Left 1013591157 6:111620512-111620534 CCATCTCCTACATCCTGTGGGAA No data
Right 1013591169 6:111620553-111620575 CCTTTCTAAGGCATCTTGGGAGG No data
1013591158_1013591169 12 Left 1013591158 6:111620518-111620540 CCTACATCCTGTGGGAAGTCCAG No data
Right 1013591169 6:111620553-111620575 CCTTTCTAAGGCATCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013591169 Original CRISPR CCTTTCTAAGGCATCTTGGG AGG Intergenic
No off target data available for this crispr