ID: 1013591457

View in Genome Browser
Species Human (GRCh38)
Location 6:111622471-111622493
Sequence CTGTGGGTATGGTGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013591453_1013591457 -8 Left 1013591453 6:111622456-111622478 CCAGACAATGCCAGGCTGTGGGT No data
Right 1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG No data
1013591448_1013591457 3 Left 1013591448 6:111622445-111622467 CCATTCTCCTTCCAGACAATGCC No data
Right 1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG No data
1013591450_1013591457 -4 Left 1013591450 6:111622452-111622474 CCTTCCAGACAATGCCAGGCTGT No data
Right 1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013591457 Original CRISPR CTGTGGGTATGGTGGAAAGA AGG Intergenic
No off target data available for this crispr