ID: 1013591754

View in Genome Browser
Species Human (GRCh38)
Location 6:111624608-111624630
Sequence ACAATGCTGCTATAAATACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013591754_1013591757 22 Left 1013591754 6:111624608-111624630 CCGTGTATTTATAGCAGCATTGT No data
Right 1013591757 6:111624653-111624675 ACAACCCAAATATCCATCAGAGG 0: 3
1: 46
2: 225
3: 856
4: 2386
1013591754_1013591760 27 Left 1013591754 6:111624608-111624630 CCGTGTATTTATAGCAGCATTGT No data
Right 1013591760 6:111624658-111624680 CCAAATATCCATCAGAGGATAGG No data
1013591754_1013591755 -3 Left 1013591754 6:111624608-111624630 CCGTGTATTTATAGCAGCATTGT No data
Right 1013591755 6:111624628-111624650 TGTTTGCAATAGCCAAAATGTGG No data
1013591754_1013591761 30 Left 1013591754 6:111624608-111624630 CCGTGTATTTATAGCAGCATTGT No data
Right 1013591761 6:111624661-111624683 AATATCCATCAGAGGATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013591754 Original CRISPR ACAATGCTGCTATAAATACA CGG (reversed) Intergenic
No off target data available for this crispr