ID: 1013591756

View in Genome Browser
Species Human (GRCh38)
Location 6:111624640-111624662
Sequence TTTGGGTTGTTGCCACATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013591756_1013591764 29 Left 1013591756 6:111624640-111624662 CCAAAATGTGGCAACAACCCAAA No data
Right 1013591764 6:111624692-111624714 AATGTGGTCTATACATACAGTGG No data
1013591756_1013591757 -10 Left 1013591756 6:111624640-111624662 CCAAAATGTGGCAACAACCCAAA No data
Right 1013591757 6:111624653-111624675 ACAACCCAAATATCCATCAGAGG 0: 3
1: 46
2: 225
3: 856
4: 2386
1013591756_1013591765 30 Left 1013591756 6:111624640-111624662 CCAAAATGTGGCAACAACCCAAA No data
Right 1013591765 6:111624693-111624715 ATGTGGTCTATACATACAGTGGG No data
1013591756_1013591761 -2 Left 1013591756 6:111624640-111624662 CCAAAATGTGGCAACAACCCAAA No data
Right 1013591761 6:111624661-111624683 AATATCCATCAGAGGATAGGTGG No data
1013591756_1013591763 13 Left 1013591756 6:111624640-111624662 CCAAAATGTGGCAACAACCCAAA No data
Right 1013591763 6:111624676-111624698 ATAGGTGGATAAACAGAATGTGG No data
1013591756_1013591760 -5 Left 1013591756 6:111624640-111624662 CCAAAATGTGGCAACAACCCAAA No data
Right 1013591760 6:111624658-111624680 CCAAATATCCATCAGAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013591756 Original CRISPR TTTGGGTTGTTGCCACATTT TGG (reversed) Intergenic
No off target data available for this crispr