ID: 1013591761

View in Genome Browser
Species Human (GRCh38)
Location 6:111624661-111624683
Sequence AATATCCATCAGAGGATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013591754_1013591761 30 Left 1013591754 6:111624608-111624630 CCGTGTATTTATAGCAGCATTGT No data
Right 1013591761 6:111624661-111624683 AATATCCATCAGAGGATAGGTGG No data
1013591756_1013591761 -2 Left 1013591756 6:111624640-111624662 CCAAAATGTGGCAACAACCCAAA No data
Right 1013591761 6:111624661-111624683 AATATCCATCAGAGGATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013591761 Original CRISPR AATATCCATCAGAGGATAGG TGG Intergenic
No off target data available for this crispr